Incidental Mutation 'R0575:Pcdh20'
ID56198
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Nameprotocadherin 20
SynonymsC630015B17Rik, PCDH13
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0575 (G1)
Quality Score204
Status Validated
Chromosome14
Chromosomal Location88464743-88471396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88467612 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 751 (S751P)
Ref Sequence ENSEMBL: ENSMUSP00000141860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
Predicted Effect probably damaging
Transcript: ENSMUST00000061628
AA Change: S751P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: S751P

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192557
AA Change: S751P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: S751P

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Meta Mutation Damage Score 0.4937 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88467881 missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88467200 missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88470908 missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88469595 missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88468844 missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88467002 utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88467308 missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88468947 missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88469003 missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88468668 missense probably benign
R0789:Pcdh20 UTSW 14 88468790 missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88468301 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88468322 missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88467974 missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88469184 missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88468704 missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88467155 missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88467548 missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88467236 missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88468463 missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88468179 missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88468998 missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88468430 missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88467616 missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88467668 missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88469726 missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88468915 missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88468377 missense probably benign
R5652:Pcdh20 UTSW 14 88467324 missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88470876 missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88467254 missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88468602 missense probably benign
R7044:Pcdh20 UTSW 14 88469171 missense probably damaging 0.98
R7224:Pcdh20 UTSW 14 88469075 missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88468667 missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88468614 missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88469153 missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88469367 missense probably benign
R7706:Pcdh20 UTSW 14 88467357 missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7892:Pcdh20 UTSW 14 88467431 nonsense probably null
R7915:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7975:Pcdh20 UTSW 14 88467431 nonsense probably null
X0028:Pcdh20 UTSW 14 88467617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCAAGGCTTCCTCCAGAGTG -3'
(R):5'- CCCTGTCCGTAATGAACCAGAGTG -3'

Sequencing Primer
(F):5'- GACAGCATTCATGCCTGTGT -3'
(R):5'- GACATTTTTGTCATAGACACAGGC -3'
Posted On2013-07-11