Incidental Mutation 'R7223:Zscan10'
ID561980
Institutional Source Beutler Lab
Gene Symbol Zscan10
Ensembl Gene ENSMUSG00000023902
Gene Namezinc finger and SCAN domain containing 10
SynonymsZscan10, Zfp206
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001033425.3; MGI:3040700

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23600856-23611019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23609482 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 333 (D333N)
Ref Sequence ENSEMBL: ENSMUSP00000093255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095595] [ENSMUST00000115509] [ENSMUST00000117606] [ENSMUST00000118369] [ENSMUST00000120967] [ENSMUST00000122285] [ENSMUST00000123866] [ENSMUST00000129227] [ENSMUST00000138487] [ENSMUST00000148062]
PDB Structure Crystal structure of the SCAN domain from mouse Zfp206 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000095595
AA Change: D333N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093255
Gene: ENSMUSG00000023902
AA Change: D333N

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 343 366 4.4e-2 SMART
ZnF_C2H2 378 400 5.59e-4 SMART
ZnF_C2H2 406 428 1.25e-1 SMART
ZnF_C2H2 434 456 2.05e-2 SMART
ZnF_C2H2 478 500 2.75e-3 SMART
low complexity region 507 521 N/A INTRINSIC
ZnF_C2H2 524 547 1.82e-3 SMART
ZnF_C2H2 553 575 3.16e-3 SMART
ZnF_C2H2 581 603 1.95e-3 SMART
ZnF_C2H2 609 631 4.17e-3 SMART
ZnF_C2H2 637 659 1.56e-2 SMART
ZnF_C2H2 665 687 2.4e-3 SMART
ZnF_C2H2 693 715 1.98e-4 SMART
ZnF_C2H2 726 748 1.58e-3 SMART
ZnF_C2H2 754 776 6.42e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115509
AA Change: D223N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111171
Gene: ENSMUSG00000023902
AA Change: D223N

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 233 256 4.4e-2 SMART
ZnF_C2H2 268 290 5.59e-4 SMART
ZnF_C2H2 296 318 1.25e-1 SMART
ZnF_C2H2 324 346 2.05e-2 SMART
ZnF_C2H2 368 390 2.75e-3 SMART
low complexity region 397 411 N/A INTRINSIC
ZnF_C2H2 414 437 1.82e-3 SMART
ZnF_C2H2 443 465 3.16e-3 SMART
ZnF_C2H2 471 493 1.95e-3 SMART
ZnF_C2H2 499 521 4.17e-3 SMART
ZnF_C2H2 527 549 1.56e-2 SMART
ZnF_C2H2 555 577 2.4e-3 SMART
ZnF_C2H2 583 605 1.98e-4 SMART
ZnF_C2H2 616 638 1.58e-3 SMART
ZnF_C2H2 644 666 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117606
SMART Domains Protein: ENSMUSP00000112460
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 147 1.73e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118369
SMART Domains Protein: ENSMUSP00000113757
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120967
SMART Domains Protein: ENSMUSP00000113386
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 346 368 5.59e-4 SMART
ZnF_C2H2 374 396 1.25e-1 SMART
ZnF_C2H2 402 424 2.05e-2 SMART
ZnF_C2H2 446 468 2.75e-3 SMART
low complexity region 475 489 N/A INTRINSIC
ZnF_C2H2 492 515 1.82e-3 SMART
ZnF_C2H2 521 543 3.16e-3 SMART
ZnF_C2H2 549 571 1.95e-3 SMART
ZnF_C2H2 577 599 4.17e-3 SMART
ZnF_C2H2 605 627 1.56e-2 SMART
ZnF_C2H2 633 655 2.4e-3 SMART
ZnF_C2H2 661 683 1.98e-4 SMART
ZnF_C2H2 694 716 1.58e-3 SMART
ZnF_C2H2 722 744 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122285
SMART Domains Protein: ENSMUSP00000112559
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123866
AA Change: D257N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116748
Gene: ENSMUSG00000023902
AA Change: D257N

DomainStartEndE-ValueType
SCAN 39 148 2.38e-34 SMART
ZnF_C2H2 267 290 4.4e-2 SMART
ZnF_C2H2 302 324 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129227
SMART Domains Protein: ENSMUSP00000118987
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
ZnF_C2H2 142 164 5.59e-4 SMART
ZnF_C2H2 170 192 1.25e-1 SMART
ZnF_C2H2 198 220 2.05e-2 SMART
ZnF_C2H2 242 264 2.75e-3 SMART
low complexity region 271 285 N/A INTRINSIC
ZnF_C2H2 288 311 1.82e-3 SMART
ZnF_C2H2 317 339 3.16e-3 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 4.17e-3 SMART
ZnF_C2H2 401 423 1.56e-2 SMART
ZnF_C2H2 429 451 2.4e-3 SMART
ZnF_C2H2 457 479 1.98e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138487
SMART Domains Protein: ENSMUSP00000114341
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 236 258 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148062
SMART Domains Protein: ENSMUSP00000120876
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
Pfam:SCAN 37 88 7.5e-20 PFAM
low complexity region 128 149 N/A INTRINSIC
ZnF_C2H2 301 323 5.59e-4 SMART
ZnF_C2H2 329 351 1.25e-1 SMART
ZnF_C2H2 357 379 2.05e-2 SMART
ZnF_C2H2 401 423 2.75e-3 SMART
low complexity region 430 444 N/A INTRINSIC
ZnF_C2H2 447 470 1.82e-3 SMART
ZnF_C2H2 476 498 3.16e-3 SMART
ZnF_C2H2 504 526 1.95e-3 SMART
ZnF_C2H2 532 554 4.17e-3 SMART
ZnF_C2H2 560 582 1.56e-2 SMART
ZnF_C2H2 588 610 2.4e-3 SMART
ZnF_C2H2 616 638 1.98e-4 SMART
ZnF_C2H2 649 671 1.58e-3 SMART
ZnF_C2H2 677 699 6.42e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit a pleiotropic phenotype including reduced weight, mild hypoplasia in the spleen, heart and long bones, eye malformations including microphthalmia, altered platelet counts, an activated immune status, and behavioral alterations. [provided by MGI curators]
Allele List at MGI

All alleles(357) : Targeted(5) Gene trapped(352)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Other mutations in Zscan10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zscan10 APN 17 23609461 missense probably damaging 0.98
IGL01353:Zscan10 APN 17 23609600 missense probably damaging 1.00
IGL02327:Zscan10 APN 17 23607572 splice site probably benign
IGL02556:Zscan10 APN 17 23608145 missense possibly damaging 0.90
FR4737:Zscan10 UTSW 17 23609445 small deletion probably benign
P0043:Zscan10 UTSW 17 23609620 nonsense probably null
R0345:Zscan10 UTSW 17 23610082 missense probably damaging 1.00
R0401:Zscan10 UTSW 17 23605915 missense probably damaging 1.00
R0699:Zscan10 UTSW 17 23608118 missense probably damaging 1.00
R0838:Zscan10 UTSW 17 23610034 missense possibly damaging 0.83
R0919:Zscan10 UTSW 17 23610007 missense probably damaging 0.99
R1940:Zscan10 UTSW 17 23609852 missense probably damaging 1.00
R4647:Zscan10 UTSW 17 23610340 missense probably benign
R4753:Zscan10 UTSW 17 23607234 missense probably damaging 0.99
R4971:Zscan10 UTSW 17 23607173 missense possibly damaging 0.67
R5110:Zscan10 UTSW 17 23609632 missense probably damaging 1.00
R5410:Zscan10 UTSW 17 23610421 missense probably damaging 1.00
R5516:Zscan10 UTSW 17 23609359 missense possibly damaging 0.66
R5871:Zscan10 UTSW 17 23607267 intron probably benign
R6109:Zscan10 UTSW 17 23607129 missense probably damaging 0.98
R6626:Zscan10 UTSW 17 23605857 missense probably damaging 1.00
R6750:Zscan10 UTSW 17 23607190 missense possibly damaging 0.49
R6846:Zscan10 UTSW 17 23605607 missense probably damaging 0.97
R7184:Zscan10 UTSW 17 23607029 splice site probably null
R7436:Zscan10 UTSW 17 23610005 missense possibly damaging 0.52
R8224:Zscan10 UTSW 17 23609392 missense probably benign
R8366:Zscan10 UTSW 17 23609978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAATGCCTGACAATGAG -3'
(R):5'- ATGTGCAGCTTGAGGATCGAG -3'

Sequencing Primer
(F):5'- CCTGACAATGAGGAACTTAAAGTTG -3'
(R):5'- GAGCTGCGTCCAAAAGTCTTC -3'
Posted On2019-06-26