Incidental Mutation 'R7223:Baiap3'
ID561982
Institutional Source Beutler Lab
Gene Symbol Baiap3
Ensembl Gene ENSMUSG00000047507
Gene NameBAI1-associated protein 3
SynonymsLOC381076
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25242659-25256364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25243840 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1075 (R1075C)
Ref Sequence ENSEMBL: ENSMUSP00000138254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038973] [ENSMUST00000063574] [ENSMUST00000115154] [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: R1088C

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
Pfam:Membr_traf_MHD 896 958 8e-10 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182056
AA Change: R1111C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: R1111C

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Pfam:Membr_traf_MHD 851 959 3.3e-30 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182435
AA Change: R1083C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: R1083C

DomainStartEndE-ValueType
C2 131 300 4.73e-17 SMART
low complexity region 333 351 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Membr_traf_MHD 823 931 3.2e-30 PFAM
C2 961 1069 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182696
Predicted Effect probably benign
Transcript: ENSMUST00000182825
AA Change: R1075C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: R1075C

DomainStartEndE-ValueType
C2 159 284 4.05e-16 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 461 473 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
Pfam:Membr_traf_MHD 815 923 3.2e-30 PFAM
C2 953 1061 7.06e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Baiap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Baiap3 APN 17 25244328 missense probably damaging 1.00
IGL00486:Baiap3 APN 17 25248377 splice site probably benign
IGL00820:Baiap3 APN 17 25248690 missense probably benign 0.20
IGL01443:Baiap3 APN 17 25245147 missense possibly damaging 0.92
IGL02282:Baiap3 APN 17 25249377 missense probably benign 0.11
IGL02341:Baiap3 APN 17 25248316 missense possibly damaging 0.52
IGL02669:Baiap3 APN 17 25244348 missense probably damaging 1.00
IGL02863:Baiap3 APN 17 25244502 splice site probably benign
IGL02993:Baiap3 APN 17 25250082 critical splice donor site probably null
R0021:Baiap3 UTSW 17 25243669 missense probably damaging 1.00
R0090:Baiap3 UTSW 17 25250070 splice site probably benign
R0276:Baiap3 UTSW 17 25243687 missense probably damaging 1.00
R0488:Baiap3 UTSW 17 25248470 critical splice donor site probably null
R0826:Baiap3 UTSW 17 25245229 missense possibly damaging 0.89
R0883:Baiap3 UTSW 17 25249101 missense probably damaging 1.00
R1700:Baiap3 UTSW 17 25249328 missense probably damaging 1.00
R1702:Baiap3 UTSW 17 25244805 missense probably damaging 1.00
R2336:Baiap3 UTSW 17 25250404 missense probably damaging 1.00
R2762:Baiap3 UTSW 17 25244575 missense probably damaging 1.00
R4454:Baiap3 UTSW 17 25249536 missense probably damaging 1.00
R4540:Baiap3 UTSW 17 25246670 missense probably damaging 1.00
R4609:Baiap3 UTSW 17 25250261 missense probably damaging 1.00
R4816:Baiap3 UTSW 17 25247295 splice site probably benign
R4979:Baiap3 UTSW 17 25246362 missense possibly damaging 0.57
R5069:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5070:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5093:Baiap3 UTSW 17 25250269 missense probably damaging 1.00
R5130:Baiap3 UTSW 17 25245342 missense probably benign 0.01
R5566:Baiap3 UTSW 17 25251733 missense probably damaging 1.00
R5572:Baiap3 UTSW 17 25251475 missense possibly damaging 0.86
R5681:Baiap3 UTSW 17 25249373 missense probably damaging 1.00
R5730:Baiap3 UTSW 17 25247524 missense probably benign 0.01
R5743:Baiap3 UTSW 17 25244785 missense probably benign 0.02
R5805:Baiap3 UTSW 17 25247515 missense probably benign 0.12
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6052:Baiap3 UTSW 17 25248470 critical splice donor site probably benign
R6238:Baiap3 UTSW 17 25245758 missense probably benign 0.00
R6700:Baiap3 UTSW 17 25244026 missense probably damaging 1.00
R7037:Baiap3 UTSW 17 25243840 missense probably benign
R7038:Baiap3 UTSW 17 25243840 missense probably benign
R7039:Baiap3 UTSW 17 25243840 missense probably benign
R7126:Baiap3 UTSW 17 25245145 missense possibly damaging 0.64
R7198:Baiap3 UTSW 17 25243840 missense probably benign
R7291:Baiap3 UTSW 17 25244317 missense probably damaging 1.00
R7438:Baiap3 UTSW 17 25249108 missense possibly damaging 0.91
R7687:Baiap3 UTSW 17 25249337 missense possibly damaging 0.88
R7877:Baiap3 UTSW 17 25251138 missense probably damaging 0.99
R7960:Baiap3 UTSW 17 25251138 missense probably damaging 0.99
X0017:Baiap3 UTSW 17 25248350 missense possibly damaging 0.92
Z1176:Baiap3 UTSW 17 25244768 missense not run
Predicted Primers PCR Primer
(F):5'- GCTCCTTGAGTTTCTTGACAAAC -3'
(R):5'- CCCGTGTACGATGAACTCTTCC -3'

Sequencing Primer
(F):5'- AGTTTCTTGACAAACTCCTGTGC -3'
(R):5'- GTACGATGAACTCTTCCACTTGTGAG -3'
Posted On2019-06-26