Mutagenetix > Incidental Mutations

Incidental Mutation 'R7223:Nkx2-5'

561983

Institutional Source

Beutler Lab

Gene Symbol

Nkx2-5

Ensembl Gene

ENSMUSG00000015579

Gene Name

NK2 homeobox 5

Synonyms

Csx, Nkx2.5, Nkx-2.5, tinman

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7223 (G1)

Quality Score

178.009

Status

Not validated

Chromosome

Chromosomal Location

26838664-26841565 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26839620 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 120 (E120G)

Ref Sequence

ENSEMBL: ENSMUSP00000015723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015723]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015723
AA Change: E120G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000015723
Gene: ENSMUSG00000015579
AA Change: E120G

Domain	Start	End	E-Value	Type
low complexity region	98	110	N/A	INTRINSIC
HOX	137	199	1.26e-23	SMART
low complexity region	203	221	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor. This transcription factor functions in heart formation and development. Mutations in this gene cause atrial septal defect with atrioventricular conduction defect, and also tetralogy of Fallot, which are both heart malformation diseases. Mutations in this gene can also cause congenital hypothyroidism non-goitrous type 5, a non-autoimmune condition. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants show cardiac development arrest after looping, growth retardation, hematopoiesis and angiogenesis defects in yolk sac, and die at embryonic day 9-10. Heterozygotes also show cardiac developmental defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Anpep	A	T	7: 79,825,310	L914Q	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Hps3	A	T	3: 20,030,419	S202T	probably benign	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Lama3	C	T	18: 12,582,608	T1707I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Slc4a10	T	A	2: 62,268,665	Y586N	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Sorcs1	C	T	19: 50,190,042	V881I	probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpp2	T	A	1: 43,968,888	D417E	probably damaging	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Nkx2-5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1464:Nkx2-5	UTSW	17	26839279	missense	probably benign	0.01
R1464:Nkx2-5	UTSW	17	26839279	missense	probably benign	0.01
R5836:Nkx2-5	UTSW	17	26839089	missense	possibly damaging	0.82
R6324:Nkx2-5	UTSW	17	26841121	missense	probably benign
R6868:Nkx2-5	UTSW	17	26841294	missense	probably damaging	1.00
R7962:Nkx2-5	UTSW	17	26839176	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGATCTTGACCTGCGTGGAC -3'
(R):5'- TTCCCAGATGCGCAATTGC -3'

Sequencing Primer
(F):5'- TGGACGTGAGCTTCAGCAC -3'
(R):5'- GCAATTGCGCCAACATCG -3'

Posted On

2019-06-26