Mutagenetix > Incidental Mutation

Incidental Mutation 'R7223:Lama3'

561985

Institutional Source

Beutler Lab

Gene Symbol

Lama3

Ensembl Gene

ENSMUSG00000024421

Gene Name

laminin, alpha 3

Synonyms

[a]3B, nicein, 150kDa

MMRRC Submission

045295-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12333819-12583013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12582608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1707 (T1707I)

Ref Sequence

ENSEMBL: ENSMUSP00000140104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092070
AA Change: T3313I

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: T3313I

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LamNT	38	294	1.46e-153	SMART
EGF_Lam	296	350	1.39e-4	SMART
EGF_Lam	353	420	2.66e-10	SMART
EGF_Lam	423	464	3.51e-10	SMART
EGF_Lam	488	530	1.73e-9	SMART
EGF_Lam	533	576	3.81e-11	SMART
EGF_like	579	625	1.82e-1	SMART
EGF_Lam	628	678	5.15e-8	SMART
EGF_Lam	681	725	3.54e-6	SMART
low complexity region	768	781	N/A	INTRINSIC
EGF_Lam	1263	1306	3.15e-12	SMART
EGF_Lam	1309	1350	6.3e-3	SMART
EGF_Lam	1353	1399	1.49e-13	SMART
EGF_Lam	1402	1450	8.18e-11	SMART
LamB	1509	1638	4.34e-55	SMART
Pfam:Laminin_EGF	1647	1681	7.9e-5	PFAM
EGF_Lam	1684	1728	2.66e-10	SMART
EGF_Lam	1731	1781	7.81e-8	SMART
Pfam:Laminin_I	1836	2102	2.7e-93	PFAM
low complexity region	2185	2200	N/A	INTRINSIC
coiled coil region	2211	2238	N/A	INTRINSIC
LamG	2406	2566	1.67e-2	SMART
LamG	2614	2742	1.72e-17	SMART
LamG	2785	2900	3.96e-17	SMART
LamG	3005	3133	1.12e-34	SMART
LamG	3175	3308	3.41e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188815
AA Change: T1707I

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: T1707I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_Lam	78	122	2.66e-10	SMART
EGF_Lam	125	175	7.81e-8	SMART
Pfam:Laminin_I	230	496	1e-90	PFAM
low complexity region	579	594	N/A	INTRINSIC
coiled coil region	605	632	N/A	INTRINSIC
LamG	800	960	1.67e-2	SMART
LamG	1008	1136	1.72e-17	SMART
LamG	1179	1294	3.96e-17	SMART
LamG	1399	1527	1.12e-34	SMART
LamG	1569	1702	3.41e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Anpep	A	T	7: 79,825,310	L914Q	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Hps3	A	T	3: 20,030,419	S202T	probably benign	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Nkx2-5	T	C	17: 26,839,620	E120G	possibly damaging	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Slc4a10	T	A	2: 62,268,665	Y586N	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Sorcs1	C	T	19: 50,190,042	V881I	probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpp2	T	A	1: 43,968,888	D417E	probably damaging	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Lama3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Lama3	APN	18	12580292	missense	probably benign
IGL00272:Lama3	APN	18	12491548	missense	probably damaging	1.00
IGL00335:Lama3	APN	18	12449588	splice site	probably benign
IGL00836:Lama3	APN	18	12472228	missense	probably benign	0.01
IGL01017:Lama3	APN	18	12441143	critical splice donor site	probably null
IGL01025:Lama3	APN	18	12481037	missense	probably benign	0.09
IGL01394:Lama3	APN	18	12531926	missense	probably null	0.39
IGL01545:Lama3	APN	18	12441131	missense	probably benign	0.01
IGL01685:Lama3	APN	18	12453880	splice site	probably benign
IGL01863:Lama3	APN	18	12419936	splice site	probably benign
IGL01869:Lama3	APN	18	12524763	missense	possibly damaging	0.94
IGL01894:Lama3	APN	18	12572064	missense	probably benign	0.09
IGL02027:Lama3	APN	18	12516513	missense	probably damaging	1.00
IGL02106:Lama3	APN	18	12468314	missense	probably damaging	0.98
IGL02307:Lama3	APN	18	12581783	missense	probably benign	0.09
IGL02342:Lama3	APN	18	12491476	missense	probably damaging	1.00
IGL02377:Lama3	APN	18	12556750	missense	possibly damaging	0.49
IGL02401:Lama3	APN	18	12557727	missense	probably benign	0.02
IGL02517:Lama3	APN	18	12537858	critical splice donor site	probably null
IGL02644:Lama3	APN	18	12525853	missense	probably benign	0.12
IGL02733:Lama3	APN	18	12578127	missense	probably damaging	0.99
IGL02932:Lama3	APN	18	12528801	missense	probably damaging	1.00
IGL03006:Lama3	APN	18	12468368	splice site	probably benign
IGL03038:Lama3	APN	18	12419250	missense	probably damaging	0.99
IGL03064:Lama3	APN	18	12439349	missense	possibly damaging	0.72
IGL03146:Lama3	APN	18	12527624	missense	possibly damaging	0.66
IGL03233:Lama3	APN	18	12481038	missense	probably damaging	1.00
IGL03255:Lama3	APN	18	12539703	missense	probably damaging	1.00
IGL03369:Lama3	APN	18	12553283	missense	probably benign	0.05
IGL03412:Lama3	APN	18	12419182	missense	probably damaging	0.99
IGL02980:Lama3	UTSW	18	12553231	missense	probably benign	0.01
IGL03014:Lama3	UTSW	18	12539967	missense	possibly damaging	0.95
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0106:Lama3	UTSW	18	12403982	missense	probably damaging	0.96
R0148:Lama3	UTSW	18	12448272	missense	probably damaging	1.00
R0165:Lama3	UTSW	18	12524810	missense	probably damaging	0.99
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0316:Lama3	UTSW	18	12519877	missense	probably benign	0.09
R0325:Lama3	UTSW	18	12482126	missense	probably damaging	1.00
R0365:Lama3	UTSW	18	12507007	missense	probably damaging	0.96
R0390:Lama3	UTSW	18	12407563	missense	probably benign	0.10
R0408:Lama3	UTSW	18	12456837	missense	probably benign
R0449:Lama3	UTSW	18	12500512	splice site	probably null
R0453:Lama3	UTSW	18	12465478	missense	possibly damaging	0.63
R0480:Lama3	UTSW	18	12450424	missense	possibly damaging	0.81
R0536:Lama3	UTSW	18	12525894	missense	probably damaging	1.00
R0545:Lama3	UTSW	18	12561701	missense	possibly damaging	0.90
R0567:Lama3	UTSW	18	12549252	missense	probably benign
R0605:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R0617:Lama3	UTSW	18	12419258	critical splice donor site	probably null
R0629:Lama3	UTSW	18	12419245	missense	possibly damaging	0.79
R0671:Lama3	UTSW	18	12477590	missense	possibly damaging	0.80
R0730:Lama3	UTSW	18	12456850	splice site	probably benign
R1216:Lama3	UTSW	18	12421134	splice site	probably benign
R1356:Lama3	UTSW	18	12500577	unclassified	probably benign
R1386:Lama3	UTSW	18	12477370	missense	probably benign	0.04
R1424:Lama3	UTSW	18	12519991	missense	probably benign	0.13
R1426:Lama3	UTSW	18	12481098	critical splice donor site	probably null
R1437:Lama3	UTSW	18	12549227	missense	possibly damaging	0.46
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1472:Lama3	UTSW	18	12482045	missense	probably benign	0.23
R1557:Lama3	UTSW	18	12513731	splice site	probably benign
R1571:Lama3	UTSW	18	12539717	missense	probably damaging	0.98
R1599:Lama3	UTSW	18	12450400	nonsense	probably null
R1631:Lama3	UTSW	18	12407494	missense	probably damaging	1.00
R1647:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1648:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1719:Lama3	UTSW	18	12479872	critical splice donor site	probably null
R1757:Lama3	UTSW	18	12465499	missense	probably benign	0.10
R1766:Lama3	UTSW	18	12402062	missense	probably damaging	1.00
R1853:Lama3	UTSW	18	12513705	missense	possibly damaging	0.75
R1856:Lama3	UTSW	18	12537781	nonsense	probably null
R1909:Lama3	UTSW	18	12581798	missense	probably benign	0.19
R1913:Lama3	UTSW	18	12495279	missense	probably benign	0.15
R1975:Lama3	UTSW	18	12453863	missense	probably damaging	1.00
R2014:Lama3	UTSW	18	12524721	splice site	probably benign
R2059:Lama3	UTSW	18	12528333	missense	probably damaging	0.98
R2060:Lama3	UTSW	18	12528726	missense	probably benign	0.30
R2086:Lama3	UTSW	18	12524830	missense	probably benign	0.39
R2115:Lama3	UTSW	18	12402849	missense	possibly damaging	0.94
R2291:Lama3	UTSW	18	12525079	missense	probably damaging	0.98
R2860:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2861:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2862:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R3410:Lama3	UTSW	18	12413858	critical splice donor site	probably null
R3614:Lama3	UTSW	18	12448288	missense	probably benign	0.03
R3696:Lama3	UTSW	18	12439475	splice site	probably benign
R3752:Lama3	UTSW	18	12507029	missense	probably damaging	1.00
R3967:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3968:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3969:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3970:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R4088:Lama3	UTSW	18	12504308	nonsense	probably null
R4118:Lama3	UTSW	18	12450431	missense	probably benign	0.01
R4222:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4223:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4224:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4225:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4367:Lama3	UTSW	18	12513690	missense	probably damaging	1.00
R4404:Lama3	UTSW	18	12582531	missense	probably benign	0.01
R4424:Lama3	UTSW	18	12519872	nonsense	probably null
R4483:Lama3	UTSW	18	12549253	missense	probably benign	0.32
R4484:Lama3	UTSW	18	12481088	missense	probably benign
R4516:Lama3	UTSW	18	12495358	missense	probably damaging	1.00
R4556:Lama3	UTSW	18	12479759	missense	possibly damaging	0.63
R4616:Lama3	UTSW	18	12504397	critical splice donor site	probably null
R4702:Lama3	UTSW	18	12578029	nonsense	probably null
R4704:Lama3	UTSW	18	12553223	missense	probably benign	0.08
R4750:Lama3	UTSW	18	12504359	missense	probably benign	0.25
R4753:Lama3	UTSW	18	12482084	missense	probably damaging	1.00
R4767:Lama3	UTSW	18	12500563	missense	probably benign	0.32
R4777:Lama3	UTSW	18	12413771	missense	probably damaging	1.00
R4782:Lama3	UTSW	18	12411570	nonsense	probably null
R4784:Lama3	UTSW	18	12449544	missense	probably benign	0.20
R4816:Lama3	UTSW	18	12477604	missense	possibly damaging	0.93
R4833:Lama3	UTSW	18	12441131	missense	probably benign	0.01
R4854:Lama3	UTSW	18	12411542	missense	probably benign	0.00
R4863:Lama3	UTSW	18	12498678	intron	probably benign
R4863:Lama3	UTSW	18	12539793	missense	probably damaging	0.99
R4953:Lama3	UTSW	18	12448305	missense	probably damaging	1.00
R4974:Lama3	UTSW	18	12552826	missense	probably damaging	0.98
R4996:Lama3	UTSW	18	12518743	missense	probably benign	0.24
R5049:Lama3	UTSW	18	12582611	missense	probably benign	0.19
R5057:Lama3	UTSW	18	12531948	missense	probably null	0.82
R5090:Lama3	UTSW	18	12542402	missense	possibly damaging	0.94
R5122:Lama3	UTSW	18	12539766	missense	possibly damaging	0.53
R5215:Lama3	UTSW	18	12577900	missense	probably damaging	1.00
R5245:Lama3	UTSW	18	12419893	missense	probably damaging	1.00
R5259:Lama3	UTSW	18	12465508	missense	probably damaging	1.00
R5320:Lama3	UTSW	18	12552855	missense	probably damaging	0.99
R5377:Lama3	UTSW	18	12453746	missense	probably damaging	0.99
R5432:Lama3	UTSW	18	12572066	missense	probably damaging	1.00
R5500:Lama3	UTSW	18	12456764	missense	possibly damaging	0.93
R5534:Lama3	UTSW	18	12553210	missense	probably benign	0.00
R5589:Lama3	UTSW	18	12472220	missense	possibly damaging	0.46
R5604:Lama3	UTSW	18	12439348	missense	probably benign
R5617:Lama3	UTSW	18	12498936	intron	probably benign
R5709:Lama3	UTSW	18	12539799	missense	probably damaging	1.00
R5965:Lama3	UTSW	18	12429887	missense	possibly damaging	0.67
R6042:Lama3	UTSW	18	12574254	missense	probably damaging	1.00
R6065:Lama3	UTSW	18	12469928	missense	possibly damaging	0.53
R6085:Lama3	UTSW	18	12482099	missense	probably benign	0.01
R6212:Lama3	UTSW	18	12513645	missense	probably damaging	1.00
R6268:Lama3	UTSW	18	12524737	missense	probably damaging	0.98
R6276:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R6366:Lama3	UTSW	18	12482137	missense	probably damaging	1.00
R6393:Lama3	UTSW	18	12479756	missense	probably benign	0.44
R6493:Lama3	UTSW	18	12482148	critical splice donor site	probably null
R6505:Lama3	UTSW	18	12495348	missense	probably benign	0.02
R6563:Lama3	UTSW	18	12537766	missense	probably damaging	1.00
R6582:Lama3	UTSW	18	12577840	missense	probably damaging	1.00
R6585:Lama3	UTSW	18	12419257	critical splice donor site	probably null
R6609:Lama3	UTSW	18	12513678	missense	probably damaging	0.99
R6656:Lama3	UTSW	18	12549226	missense	possibly damaging	0.66
R6833:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R6834:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R7019:Lama3	UTSW	18	12528418	missense	probably damaging	0.97
R7026:Lama3	UTSW	18	12516548	missense	probably damaging	0.98
R7088:Lama3	UTSW	18	12582545	missense	possibly damaging	0.90
R7100:Lama3	UTSW	18	12582644	missense	possibly damaging	0.80
R7102:Lama3	UTSW	18	12552813	missense	possibly damaging	0.66
R7103:Lama3	UTSW	18	12531879	missense	probably benign	0.00
R7121:Lama3	UTSW	18	12462782	missense	probably benign	0.06
R7133:Lama3	UTSW	18	12539786	missense	probably benign	0.05
R7150:Lama3	UTSW	18	12468289	missense	probably damaging	1.00
R7158:Lama3	UTSW	18	12456812	missense	probably benign	0.20
R7170:Lama3	UTSW	18	12404076	missense	probably benign	0.26
R7216:Lama3	UTSW	18	12430000	missense	probably damaging	1.00
R7243:Lama3	UTSW	18	12419845	missense	probably damaging	1.00
R7282:Lama3	UTSW	18	12439392	missense	probably damaging	0.99
R7337:Lama3	UTSW	18	12507040	splice site	probably null
R7442:Lama3	UTSW	18	12472181	critical splice acceptor site	probably null
R7487:Lama3	UTSW	18	12419237	missense	probably benign
R7604:Lama3	UTSW	18	12500493	missense	possibly damaging	0.93
R7609:Lama3	UTSW	18	12531834	critical splice acceptor site	probably null
R7650:Lama3	UTSW	18	12537838	missense	probably benign	0.01
R7894:Lama3	UTSW	18	12462807	missense	probably benign	0.07
R7975:Lama3	UTSW	18	12537739	missense	probably damaging	1.00
R8099:Lama3	UTSW	18	12534063	missense	probably damaging	0.97
R8168:Lama3	UTSW	18	12506942	missense	probably null
R8219:Lama3	UTSW	18	12439360	missense	probably benign	0.07
R8227:Lama3	UTSW	18	12407551	missense	probably benign
R8229:Lama3	UTSW	18	12407551	missense	probably benign
R8298:Lama3	UTSW	18	12525853	missense	probably benign	0.12
R8351:Lama3	UTSW	18	12540613	missense	probably damaging	1.00
R8364:Lama3	UTSW	18	12528347	missense	probably damaging	0.99
R8463:Lama3	UTSW	18	12449839	missense	probably damaging	0.96
R8515:Lama3	UTSW	18	12411631	missense	probably null	0.01
R8784:Lama3	UTSW	18	12421155	missense	probably benign
R8799:Lama3	UTSW	18	12490943	missense	probably damaging	0.96
R8874:Lama3	UTSW	18	12449586	critical splice donor site	probably null
R8938:Lama3	UTSW	18	12556705	missense	probably damaging	1.00
R8967:Lama3	UTSW	18	12532039	missense	possibly damaging	0.46
R9039:Lama3	UTSW	18	12481063	nonsense	probably null
R9126:Lama3	UTSW	18	12450470	missense	probably damaging	1.00
R9200:Lama3	UTSW	18	12472240	missense	probably benign	0.00
R9203:Lama3	UTSW	18	12462812	missense	probably benign	0.04
R9246:Lama3	UTSW	18	12577902	missense	probably damaging	0.99
R9284:Lama3	UTSW	18	12450484	nonsense	probably null
R9553:Lama3	UTSW	18	12429962	missense	probably damaging	1.00
R9716:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R9734:Lama3	UTSW	18	12549263	missense	possibly damaging	0.94
X0019:Lama3	UTSW	18	12582574	missense	possibly damaging	0.94
Z1177:Lama3	UTSW	18	12429879	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTTTGCTACCTCTGTATCACAG -3'
(R):5'- TGCATGTGTGTCACTGAAAGAC -3'

Sequencing Primer
(F):5'- TCAGGGCCATGGAGTCTCTG -3'
(R):5'- CAGAGATCTGTACAGCACTGTGTG -3'

Posted On

2019-06-26