Mutagenetix > Incidental Mutation

Incidental Mutation 'R7223:Sorcs1'

561992

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R7223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50143299-50678646 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 50190042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 881 (V881I)

Ref Sequence

ENSEMBL: ENSMUSP00000147463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072685
AA Change: V881I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: V881I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111756
AA Change: V881I

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: V881I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164039
AA Change: V881I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: V881I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168357

SMART Domains

Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
VPS10	1	320	6.99e-58	SMART
PKD	322	412	3.84e-1	SMART
PKD	420	498	8.63e-1	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209413
AA Change: V881I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000209783
AA Change: V881I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000211008
AA Change: V881I

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000211687
AA Change: V881I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Anpep	A	T	7: 79,825,310	L914Q	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Hps3	A	T	3: 20,030,419	S202T	probably benign	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Lama3	C	T	18: 12,582,608	T1707I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Nkx2-5	T	C	17: 26,839,620	E120G	possibly damaging	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Slc4a10	T	A	2: 62,268,665	Y586N	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpp2	T	A	1: 43,968,888	D417E	probably damaging	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50190054	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50176128	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50228201	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50288079	splice site	probably benign
IGL01445:Sorcs1	APN	19	50153066	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50181506	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50230209	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50288159	splice site	probably benign
IGL02111:Sorcs1	APN	19	50230245	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50333598	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50182671	nonsense	probably null
IGL02498:Sorcs1	APN	19	50678168	missense	probably benign
IGL02658:Sorcs1	APN	19	50190092	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50677930	nonsense	probably null
IGL02942:Sorcs1	APN	19	50475437	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50259756	nonsense	probably null
IGL03230:Sorcs1	APN	19	50242093	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50152907	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50378891	splice site	probably benign
R0115:Sorcs1	UTSW	19	50636453	intron	probably benign
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50313042	splice site	probably null
R0481:Sorcs1	UTSW	19	50636453	intron	probably benign
R0581:Sorcs1	UTSW	19	50252701	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50241942	splice site	probably benign
R0980:Sorcs1	UTSW	19	50232323	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50144160	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50252587	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50475422	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50175043	splice site	probably benign
R1783:Sorcs1	UTSW	19	50228309	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50222195	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50678192	missense	probably benign
R2206:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50210650	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50151221	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50222159	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50190161	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50378941	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50312964	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50182669	missense	probably benign
R4780:Sorcs1	UTSW	19	50143981	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50182681	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50678140	missense	possibly damaging	0.92
R4823:Sorcs1	UTSW	19	50230302	missense	possibly damaging	0.87
R4883:Sorcs1	UTSW	19	50232303	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50259752	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50225141	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50252602	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50222133	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50182775	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50190117	nonsense	probably null
R6091:Sorcs1	UTSW	19	50288101	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50288094	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50181414	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50144124	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50225177	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50176122	nonsense	probably null
R6792:Sorcs1	UTSW	19	50678168	missense	probably benign
R6891:Sorcs1	UTSW	19	50225119	nonsense	probably null
R7151:Sorcs1	UTSW	19	50312982	missense	probably damaging	1.00
R7356:Sorcs1	UTSW	19	50175157	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50262263	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50153112	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50153052	missense	probably benign
R7506:Sorcs1	UTSW	19	50182674	nonsense	probably null
R7573:Sorcs1	UTSW	19	50152796	nonsense	probably null
R7867:Sorcs1	UTSW	19	50230260	nonsense	probably null
R7911:Sorcs1	UTSW	19	50144032	missense	unknown
R8032:Sorcs1	UTSW	19	50475408	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50143977	missense	unknown
R8463:Sorcs1	UTSW	19	50259810	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50378960	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50151220	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50252658	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50225220	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50232315	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50262295	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50152862	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50225213	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50210770	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50678083	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50678083	missense	probably benign	0.04
X0024:Sorcs1	UTSW	19	50182763	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50222143	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50226742	missense	probably null	1.00
Z1177:Sorcs1	UTSW	19	50333599	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTTTGTCTGTCACACTTCTTGG -3'
(R):5'- CACTGGTCTTTCTTACAGGGTG -3'

Sequencing Primer
(F):5'- GTCTGTCACACTTCTTGGTTCTC -3'
(R):5'- GATGTGCAGCGGACACTCATC -3'

Posted On

2019-06-26