Incidental Mutation 'R7224:Gigyf2'
ID 561996
Institutional Source Beutler Lab
Gene Symbol Gigyf2
Ensembl Gene ENSMUSG00000048000
Gene Name GRB10 interacting GYF protein 2
Synonyms 2610016F01Rik, Tnrc15, A830080H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 87326998-87450796 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87403725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 198 (I198M)
Ref Sequence ENSEMBL: ENSMUSP00000027475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000164992] [ENSMUST00000172736] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173148] [ENSMUST00000173152] [ENSMUST00000173173] [ENSMUST00000173663] [ENSMUST00000174334] [ENSMUST00000174501]
AlphaFold Q6Y7W8
Predicted Effect unknown
Transcript: ENSMUST00000027475
AA Change: I198M
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000
AA Change: I198M

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164992
AA Change: I147M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000
AA Change: I147M

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172736
SMART Domains Protein: ENSMUSP00000134620
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 49 87 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172794
AA Change: I198M
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000
AA Change: I198M

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172964
AA Change: I198M
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000
AA Change: I198M

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173148
Predicted Effect probably benign
Transcript: ENSMUST00000173152
SMART Domains Protein: ENSMUSP00000134086
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 28 66 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173173
AA Change: I198M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000
AA Change: I198M

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134677
Gene: ENSMUSG00000048000
AA Change: I19M

DomainStartEndE-ValueType
low complexity region 69 107 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
internal_repeat_1 166 206 3.2e-5 PROSPERO
internal_repeat_1 226 262 3.2e-5 PROSPERO
GYF 357 412 2.83e-26 SMART
low complexity region 442 489 N/A INTRINSIC
coiled coil region 544 745 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173636
Predicted Effect probably benign
Transcript: ENSMUST00000173663
SMART Domains Protein: ENSMUSP00000133416
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 22 60 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174334
AA Change: I24M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133666
Gene: ENSMUSG00000048000
AA Change: I24M

DomainStartEndE-ValueType
low complexity region 77 84 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174501
AA Change: I198M
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000
AA Change: I198M

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal and postnatal lethality. Mice heterozygous for a knock-out allele exhibit impaired motor coordination with motor neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Gigyf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gigyf2 APN 1 87436850 missense probably damaging 0.99
IGL01828:Gigyf2 APN 1 87419098 missense probably damaging 1.00
IGL02222:Gigyf2 APN 1 87410863 splice site probably null
IGL02259:Gigyf2 APN 1 87411837 missense probably damaging 1.00
IGL02562:Gigyf2 APN 1 87407375 missense probably benign 0.15
IGL02565:Gigyf2 APN 1 87442136 missense probably damaging 1.00
IGL02695:Gigyf2 APN 1 87416827 missense probably benign 0.07
IGL03264:Gigyf2 APN 1 87449068 splice site probably benign
Flop UTSW 1 87365266 missense probably damaging 1.00
FR4449:Gigyf2 UTSW 1 87428585 unclassified probably benign
PIT4260001:Gigyf2 UTSW 1 87419106 missense unknown
R0041:Gigyf2 UTSW 1 87378976 missense probably damaging 1.00
R0126:Gigyf2 UTSW 1 87411875 splice site probably benign
R0190:Gigyf2 UTSW 1 87428688 unclassified probably benign
R0244:Gigyf2 UTSW 1 87379015 missense possibly damaging 0.96
R0492:Gigyf2 UTSW 1 87440846 missense probably damaging 1.00
R0526:Gigyf2 UTSW 1 87421493 missense probably benign 0.00
R0612:Gigyf2 UTSW 1 87449080 missense probably damaging 1.00
R0731:Gigyf2 UTSW 1 87407727 splice site probably benign
R0783:Gigyf2 UTSW 1 87407161 missense probably damaging 0.99
R1445:Gigyf2 UTSW 1 87443638 splice site probably benign
R1620:Gigyf2 UTSW 1 87449128 missense probably damaging 1.00
R1678:Gigyf2 UTSW 1 87416983 missense probably benign 0.44
R2008:Gigyf2 UTSW 1 87374113 critical splice donor site probably null
R2111:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2112:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2180:Gigyf2 UTSW 1 87416920 missense probably damaging 1.00
R3438:Gigyf2 UTSW 1 87440580 missense probably damaging 0.96
R3690:Gigyf2 UTSW 1 87421516 missense possibly damaging 0.80
R4089:Gigyf2 UTSW 1 87443672 missense probably damaging 1.00
R4411:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4412:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4489:Gigyf2 UTSW 1 87440826 missense probably damaging 1.00
R4743:Gigyf2 UTSW 1 87365248 nonsense probably null
R4769:Gigyf2 UTSW 1 87440849 missense probably damaging 1.00
R4854:Gigyf2 UTSW 1 87354413 unclassified probably benign
R5215:Gigyf2 UTSW 1 87365266 missense probably damaging 1.00
R5326:Gigyf2 UTSW 1 87425138 unclassified probably benign
R5771:Gigyf2 UTSW 1 87446328 missense possibly damaging 0.90
R5813:Gigyf2 UTSW 1 87440763 missense probably damaging 0.99
R5964:Gigyf2 UTSW 1 87407167 missense probably damaging 1.00
R6026:Gigyf2 UTSW 1 87440732 missense probably damaging 0.99
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6784:Gigyf2 UTSW 1 87443674 missense probably damaging 1.00
R6800:Gigyf2 UTSW 1 87419176 missense possibly damaging 0.68
R6991:Gigyf2 UTSW 1 87407136 missense probably damaging 1.00
R7464:Gigyf2 UTSW 1 87428604 missense unknown
R7554:Gigyf2 UTSW 1 87407570 missense unknown
R7658:Gigyf2 UTSW 1 87419138 missense unknown
R7976:Gigyf2 UTSW 1 87403736 missense unknown
R8032:Gigyf2 UTSW 1 87407013 missense unknown
R8070:Gigyf2 UTSW 1 87440907 missense probably benign 0.03
R8071:Gigyf2 UTSW 1 87446433 missense probably damaging 0.99
R8519:Gigyf2 UTSW 1 87410709 missense probably benign 0.01
R8675:Gigyf2 UTSW 1 87403716 missense unknown
R8849:Gigyf2 UTSW 1 87433870 missense unknown
R8872:Gigyf2 UTSW 1 87380003 missense unknown
R9184:Gigyf2 UTSW 1 87440589 missense possibly damaging 0.95
X0065:Gigyf2 UTSW 1 87411867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGTACGCATGGGCAG -3'
(R):5'- GCAAGCTCTCATATCAGCCTC -3'

Sequencing Primer
(F):5'- TTGGCAGCAGAACTAGGATTCTC -3'
(R):5'- AGCCTCTTTGTGCTTTATACAACAC -3'
Posted On 2019-06-26