Mutagenetix > Incidental Mutations

Incidental Mutation 'R7224:Kcnd3'

562006

Institutional Source

Beutler Lab

Gene Symbol

Kcnd3

Ensembl Gene

ENSMUSG00000040896

Gene Name

potassium voltage-gated channel, Shal-related family, member 3

Synonyms

Kv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7224 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105452330-105674002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105669084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 615 (I615F)

Ref Sequence

ENSEMBL: ENSMUSP00000078169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]

AlphaFold

Q9Z0V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000079169
AA Change: I615F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: I615F

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098761
AA Change: I596F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: I596F

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	7.3e-19	PFAM
BTB	40	139	1.76e-16	SMART
transmembrane domain	180	202	N/A	INTRINSIC
Pfam:Ion_trans	228	402	1e-31	PFAM
Pfam:Ion_trans_2	327	408	8.4e-15	PFAM
low complexity region	412	431	N/A	INTRINSIC
Pfam:DUF3399	442	545	9.5e-52	PFAM
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118360
AA Change: I615F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: I615F

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Meta Mutation Damage Score

0.2549

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	G	8: 84,172,213	T577A	probably benign	Het
Aadac	C	T	3: 60,035,854	T60M	probably benign	Het
Actn4	C	T	7: 28,962,084	A34T	probably benign	Het
Acvrl1	A	G	15: 101,143,364	M466V	probably benign	Het
Adamts7	T	C	9: 90,185,815	Y453H	probably damaging	Het
Amfr	G	A	8: 93,984,856	P351S	probably damaging	Het
Ankrd26	G	A	6: 118,539,727	T492M	probably benign	Het
Anxa6	A	G	11: 54,986,167	F547L	probably damaging	Het
Ap5m1	T	G	14: 49,080,927	Y394D	unknown	Het
Atic	G	A	1: 71,570,855	V342I	probably benign	Het
Atl1	C	A	12: 69,955,353	T362N	probably benign	Het
Atp10a	A	T	7: 58,797,471	M654L	probably benign	Het
B3gnt5	A	T	16: 19,769,753	M241L	probably benign	Het
Bbs7	A	G	3: 36,605,728	V186A	possibly damaging	Het
C8b	T	C	4: 104,780,598	L89P	probably damaging	Het
Capn7	G	T	14: 31,370,721	E742*	probably null	Het
Ccdc162	G	A	10: 41,561,191	R1741C	probably damaging	Het
Chsy3	T	A	18: 59,408,975	L395H	probably damaging	Het
Cnot9	A	G	1: 74,517,229	T62A	probably benign	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Cyp2d12	T	A	15: 82,557,648		probably null	Het
Dnah7a	A	G	1: 53,397,261	V3974A	probably benign	Het
Dync1h1	G	A	12: 110,617,762	G533D	possibly damaging	Het
Elfn1	A	G	5: 139,972,473	S411G	probably benign	Het
Enpp3	T	C	10: 24,776,884	D725G	possibly damaging	Het
Epp13	T	G	7: 6,268,802	M77R	probably benign	Het
Fmnl1	T	C	11: 103,182,769		probably null	Het
Fndc8	T	C	11: 82,892,325	M44T	probably benign	Het
Gcgr	A	T	11: 120,534,712		probably benign	Het
Ggt1	T	A	10: 75,574,276	V14D	possibly damaging	Het
Gigyf2	A	G	1: 87,403,725	I198M	unknown	Het
Gm28710	T	C	5: 16,836,594	V615A	possibly damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm6034	T	A	17: 36,056,439	S59T	unknown	Het
Gm6408	G	A	5: 146,484,370	V270I	probably benign	Het
Gm853	C	G	4: 130,219,199	A135P	probably damaging	Het
Gpr20	A	T	15: 73,696,132	I136N	probably damaging	Het
Ide	T	C	19: 37,290,761	E565G		Het
Igsf9	T	C	1: 172,494,782	S515P	probably damaging	Het
Kbtbd12	G	A	6: 88,613,983	R416*	probably null	Het
Kcnk7	A	T	19: 5,706,777	M265L	probably benign	Het
Klhdc1	G	A	12: 69,263,149	S275N	probably damaging	Het
Lrba	A	C	3: 86,395,246	N1871T	probably damaging	Het
Lrrk1	A	G	7: 66,332,386	V169A	probably damaging	Het
Magi1	A	G	6: 93,683,089	I1175T	probably benign	Het
Man1a2	T	C	3: 100,582,053	T537A	possibly damaging	Het
Mrpl17	T	C	7: 105,810,002	N129S	probably damaging	Het
Mup5	G	A	4: 61,832,385	R174C	probably damaging	Het
Ndufaf1	G	A	2: 119,658,396	R216C	probably damaging	Het
Neb	T	C	2: 52,334,659		probably null	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr553	A	T	7: 102,614,767	M74K	probably damaging	Het
Olfr76	T	C	19: 12,120,548	T55A	probably benign	Het
Olfr875	G	A	9: 37,773,415	G252D	possibly damaging	Het
Osbpl8	C	T	10: 111,275,011	P458L	possibly damaging	Het
Pcdh20	T	C	14: 88,469,075	E263G	possibly damaging	Het
Pkd1l1	A	G	11: 8,945,241	L623P		Het
Plxdc1	T	C	11: 97,932,327	T363A	possibly damaging	Het
Pole3	T	C	4: 62,524,050	D111G	unknown	Het
R3hdm2	T	A	10: 127,458,153	L172Q	probably damaging	Het
Rbm33	T	C	5: 28,394,324	V90A		Het
Rcbtb1	C	G	14: 59,228,379	I390M	probably damaging	Het
Romo1	G	A	2: 156,144,375		probably benign	Het
Sars	A	G	3: 108,428,203	Y410H	probably damaging	Het
Sesn2	T	C	4: 132,497,413	T327A	probably benign	Het
Slc30a5	A	G	13: 100,809,254	V530A	probably damaging	Het
Slc30a9	G	A	5: 67,315,701	E43K	probably benign	Het
Slc38a2	A	C	15: 96,691,359	L418W	probably damaging	Het
Snx14	T	C	9: 88,394,561	E557G	possibly damaging	Het
Spata33	T	A	8: 123,221,998	I123K	probably damaging	Het
Tdrd3	A	T	14: 87,477,403	H170L	probably damaging	Het
Trpm1	A	G	7: 64,219,106		probably null	Het
Tsr3	A	T	17: 25,242,595	E302D	probably benign	Het
Ttll11	A	G	2: 35,902,673	I386T	probably damaging	Het
Usp2	C	T	9: 44,075,969	T188M	possibly damaging	Het
Usp44	A	G	10: 93,845,993	I102V	probably benign	Het
Wasf1	A	G	10: 40,926,550	N67S	probably benign	Het
Zfp445	T	C	9: 122,852,143	N911S	probably benign	Het
Zfp467	A	G	6: 48,444,969		probably null	Het

Other mutations in Kcnd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02296:Kcnd3	APN	3	105667001	nonsense	probably null
PIT4498001:Kcnd3	UTSW	3	105658709	missense	probably damaging	0.99
R0483:Kcnd3	UTSW	3	105459626	missense	probably damaging	1.00
R0544:Kcnd3	UTSW	3	105658759	missense	probably damaging	1.00
R1457:Kcnd3	UTSW	3	105668186	missense	probably benign	0.00
R1853:Kcnd3	UTSW	3	105459752	missense	probably damaging	1.00
R2030:Kcnd3	UTSW	3	105459537	missense	probably damaging	1.00
R2077:Kcnd3	UTSW	3	105666999	missense	probably benign	0.16
R2106:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2287:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2288:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2316:Kcnd3	UTSW	3	105669126	missense	probably benign	0.17
R2909:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2924:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2925:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3014:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3016:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3038:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3696:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3697:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3698:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3777:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3778:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3785:Kcnd3	UTSW	3	105668225	missense	possibly damaging	0.79
R3810:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3811:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3815:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3816:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3819:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3877:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3879:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3899:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4300:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4367:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4370:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4491:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4549:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4550:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4569:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4571:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4593:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4594:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4595:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4624:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4625:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4627:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4630:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4631:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4632:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4799:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4822:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R5021:Kcnd3	UTSW	3	105658754	missense	probably damaging	1.00
R5056:Kcnd3	UTSW	3	105666928	intron	probably benign
R5849:Kcnd3	UTSW	3	105458795	utr 5 prime	probably benign
R7198:Kcnd3	UTSW	3	105459540	missense	probably damaging	1.00
R7532:Kcnd3	UTSW	3	105668210	missense	probably damaging	1.00
R7578:Kcnd3	UTSW	3	105459617	missense	probably benign	0.08
R7975:Kcnd3	UTSW	3	105458994	missense	probably damaging	1.00
R8022:Kcnd3	UTSW	3	105458873	missense	probably benign	0.19
R8823:Kcnd3	UTSW	3	105667014	missense	probably benign	0.00
R8986:Kcnd3	UTSW	3	105459723	missense	probably damaging	1.00
R9056:Kcnd3	UTSW	3	105666974	missense	possibly damaging	0.48
R9345:Kcnd3	UTSW	3	105658687	missense	probably damaging	1.00
Z1177:Kcnd3	UTSW	3	105459570	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGATTATTAAAGGGCGAGATC -3'
(R):5'- AGTGGCCACTCACCAACATG -3'

Sequencing Primer
(F):5'- ACTGAGTTCCTTGACAGAGC -3'
(R):5'- AACATGCCAGCCCCTTTTAC -3'

Posted On

2019-06-26