Incidental Mutation 'R7224:Sars'
ID 562007
Institutional Source Beutler Lab
Gene Symbol Sars
Ensembl Gene ENSMUSG00000068739
Gene Name seryl-aminoacyl-tRNA synthetase
Synonyms Strs
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 108424865-108445209 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108428203 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 410 (Y410H)
Ref Sequence ENSEMBL: ENSMUSP00000099685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090553] [ENSMUST00000102625] [ENSMUST00000132467] [ENSMUST00000153499]
AlphaFold P26638
Predicted Effect possibly damaging
Transcript: ENSMUST00000090553
AA Change: Y410H

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088041
Gene: ENSMUSG00000068739
AA Change: Y410H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-20 PFAM
Pfam:tRNA-synt_2b 203 386 4.1e-39 PFAM
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102625
AA Change: Y410H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099685
Gene: ENSMUSG00000068739
AA Change: Y410H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.3e-22 PFAM
Pfam:tRNA-synt_2b 248 427 2.1e-41 PFAM
low complexity region 505 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132467
SMART Domains Protein: ENSMUSP00000120879
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 6.1e-23 PFAM
Pfam:tRNA-synt_2b 155 338 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153499
SMART Domains Protein: ENSMUSP00000118676
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-23 PFAM
PDB:3VBB|F 150 187 3e-18 PDB
Meta Mutation Damage Score 0.7699 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Sars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Sars APN 3 108426858 missense probably damaging 0.99
IGL02898:Sars APN 3 108429263 missense probably damaging 1.00
R0660:Sars UTSW 3 108431473 missense probably damaging 1.00
R0749:Sars UTSW 3 108428266 missense possibly damaging 0.95
R0855:Sars UTSW 3 108426932 missense probably benign 0.07
R1249:Sars UTSW 3 108435935 missense probably benign 0.14
R1540:Sars UTSW 3 108433145 missense probably benign 0.01
R1659:Sars UTSW 3 108429416 missense probably damaging 1.00
R1836:Sars UTSW 3 108435944 missense probably benign 0.00
R2120:Sars UTSW 3 108434156 missense probably benign 0.00
R3104:Sars UTSW 3 108429305 missense probably damaging 1.00
R3105:Sars UTSW 3 108429305 missense probably damaging 1.00
R6282:Sars UTSW 3 108428274 nonsense probably null
R7706:Sars UTSW 3 108431464 critical splice donor site probably null
R8219:Sars UTSW 3 108445062 missense probably benign 0.02
R8353:Sars UTSW 3 108428713 missense probably benign 0.14
R8398:Sars UTSW 3 108428173 critical splice donor site probably null
R8453:Sars UTSW 3 108428713 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAAGAACCCGGTCCTGATTC -3'
(R):5'- ATGTGCAGGCTTCTTCAGG -3'

Sequencing Primer
(F):5'- CGGTCCTGATTCAGCAGAAG -3'
(R):5'- TTCTTCAGGCTCGCTGCAGAG -3'
Posted On 2019-06-26