Incidental Mutation 'R7224:C8b'
ID562010
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Namecomplement component 8, beta polypeptide
Synonyms4930439B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7224 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location104766317-104804548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104780598 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 89 (L89P)
Ref Sequence ENSEMBL: ENSMUSP00000031663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
Predicted Effect probably damaging
Transcript: ENSMUST00000031663
AA Change: L89P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: L89P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065072
AA Change: L89P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: L89P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Meta Mutation Damage Score 0.3002 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104801334 splice site probably benign
IGL01145:C8b APN 4 104780580 missense probably benign 0.25
IGL01768:C8b APN 4 104786954 missense probably benign 0.00
IGL02347:C8b APN 4 104786954 missense probably benign 0.00
IGL02488:C8b APN 4 104804081 missense probably benign
IGL02957:C8b APN 4 104766455 missense probably benign
IGL02979:C8b APN 4 104774388 missense probably damaging 0.99
IGL02995:C8b APN 4 104801328 splice site probably benign
IGL03294:C8b APN 4 104780691 missense probably benign 0.06
R0568:C8b UTSW 4 104793380 missense probably benign 0.39
R1015:C8b UTSW 4 104786960 missense probably benign 0.19
R1191:C8b UTSW 4 104793323 missense probably damaging 1.00
R1401:C8b UTSW 4 104784482 missense possibly damaging 0.72
R3824:C8b UTSW 4 104783009 missense probably benign 0.42
R4611:C8b UTSW 4 104790644 missense probably damaging 0.98
R4756:C8b UTSW 4 104786886 missense probably benign
R4845:C8b UTSW 4 104791812 missense possibly damaging 0.87
R5355:C8b UTSW 4 104780663 missense probably benign 0.01
R5436:C8b UTSW 4 104800349 nonsense probably null
R5561:C8b UTSW 4 104784448 missense possibly damaging 0.89
R5967:C8b UTSW 4 104793333 missense possibly damaging 0.79
R6744:C8b UTSW 4 104774346 missense probably damaging 1.00
R6899:C8b UTSW 4 104786874 missense probably benign 0.02
R6977:C8b UTSW 4 104786996 missense possibly damaging 0.82
R7088:C8b UTSW 4 104793343 missense probably benign 0.12
R7278:C8b UTSW 4 104780627 missense probably damaging 1.00
R8058:C8b UTSW 4 104790614 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCTTGCATAGAACCTCAG -3'
(R):5'- GCAACCCTGATCTTCATGAACC -3'

Sequencing Primer
(F):5'- GCCTTGCATAGAACCTCAGTGTATG -3'
(R):5'- TCCATCATTGCATGCTACTTTATG -3'
Posted On2019-06-26