Incidental Mutation 'R7224:Zfp467'
ID 562018
Institutional Source Beutler Lab
Gene Symbol Zfp467
Ensembl Gene ENSMUSG00000068551
Gene Name zinc finger protein 467
Synonyms EZI, MNCb-3350, 1190001I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 48427697-48445825 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 48444969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000101443] [ENSMUST00000114556] [ENSMUST00000114558] [ENSMUST00000114559] [ENSMUST00000114560] [ENSMUST00000114561] [ENSMUST00000114563] [ENSMUST00000114564] [ENSMUST00000114566] [ENSMUST00000141449] [ENSMUST00000169350] [ENSMUST00000212740]
AlphaFold Q8JZL0
Predicted Effect probably benign
Transcript: ENSMUST00000043676
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101443
Predicted Effect probably benign
Transcript: ENSMUST00000114556
Predicted Effect probably benign
Transcript: ENSMUST00000114558
Predicted Effect probably null
Transcript: ENSMUST00000114559
Predicted Effect probably null
Transcript: ENSMUST00000114560
SMART Domains Protein: ENSMUSP00000110207
Gene: ENSMUSG00000068551

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114561
SMART Domains Protein: ENSMUSP00000110208
Gene: ENSMUSG00000068551

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114563
Predicted Effect probably benign
Transcript: ENSMUST00000114564
Predicted Effect probably benign
Transcript: ENSMUST00000114566
Predicted Effect probably benign
Transcript: ENSMUST00000141449
Predicted Effect probably benign
Transcript: ENSMUST00000169350
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212740
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein whose function has not yet been elucidated in humans. However, the mouse ortholog of this protein enhances adipocyte differentiation and suppresses osteoblast differentiation in bone marrow. The mouse protein also is a transcription factor for several genes and can help recruit histone deacetylase complexes. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Other mutations in Zfp467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Zfp467 UTSW 6 48438681 missense probably benign 0.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R1509:Zfp467 UTSW 6 48438687 missense possibly damaging 0.95
R1517:Zfp467 UTSW 6 48438236 missense probably damaging 1.00
R1656:Zfp467 UTSW 6 48439079 missense possibly damaging 0.87
R2131:Zfp467 UTSW 6 48442661 missense probably damaging 0.98
R2912:Zfp467 UTSW 6 48439076 missense possibly damaging 0.95
R4696:Zfp467 UTSW 6 48439357 unclassified probably benign
R4714:Zfp467 UTSW 6 48427817 missense unknown
R4993:Zfp467 UTSW 6 48439029 missense probably damaging 1.00
R7038:Zfp467 UTSW 6 48438138 missense probably damaging 1.00
R7855:Zfp467 UTSW 6 48439181 missense probably damaging 0.99
R8073:Zfp467 UTSW 6 48438025 missense probably damaging 0.99
R8093:Zfp467 UTSW 6 48443432 missense possibly damaging 0.95
R8139:Zfp467 UTSW 6 48439334 missense probably damaging 1.00
R8920:Zfp467 UTSW 6 48438480 missense probably benign 0.06
R9418:Zfp467 UTSW 6 48439056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAACCCCACATTCTCTGG -3'
(R):5'- CCCAAACGGAGCTTTACAAG -3'

Sequencing Primer
(F):5'- TAACCCCACATTCTCTGGACCTAC -3'
(R):5'- TTTACAAGCCCTGCCGAC -3'
Posted On 2019-06-26