Incidental Mutation 'R7224:Magi1'
ID562020
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 1
SynonymsAIP3, Baiap1, BAP1, Gukmi1, WWP3
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010367.2; NM_001083320.1 NM_001029850.3, NM_001083321.1; MGI: 1203522

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R7224 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location93675455-94283917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93683089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1175 (I1175T)
Ref Sequence ENSEMBL: ENSMUSP00000086730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
PDB Structure
X-ray crystal structure of MAGI-1 PDZ1 bound to the C-terminal peptide of HPV18 E6 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000055224
AA Change: I1078T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095
AA Change: I1078T

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089317
AA Change: I1175T

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: I1175T

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093769
AA Change: I959T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: I959T

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203519
AA Change: I1090T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095
AA Change: I1090T

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203688
AA Change: I959T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095
AA Change: I959T

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204347
AA Change: I1187T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095
AA Change: I1187T

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204532
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94283093 missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93747224 missense probably damaging 0.99
IGL01642:Magi1 APN 6 93686624 missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93792400 unclassified probably null
IGL01967:Magi1 APN 6 93708134 missense probably damaging 1.00
IGL01984:Magi1 APN 6 93708174 missense probably damaging 1.00
IGL02074:Magi1 APN 6 93745598 missense probably damaging 1.00
IGL02098:Magi1 APN 6 93678787 missense probably damaging 1.00
IGL02225:Magi1 APN 6 93694026 missense probably damaging 1.00
IGL02522:Magi1 APN 6 93678636 missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93785610 missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93686873 missense probably damaging 1.00
P0007:Magi1 UTSW 6 93745988 missense probably damaging 1.00
R0149:Magi1 UTSW 6 93747245 missense probably damaging 1.00
R0512:Magi1 UTSW 6 93694064 missense probably damaging 1.00
R1487:Magi1 UTSW 6 93708079 missense probably benign 0.00
R1497:Magi1 UTSW 6 93747329 missense probably damaging 1.00
R1502:Magi1 UTSW 6 93694170 missense probably damaging 1.00
R1824:Magi1 UTSW 6 93699639 missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93755045 missense probably benign
R2132:Magi1 UTSW 6 93697274 missense probably damaging 0.99
R2331:Magi1 UTSW 6 93685562 missense probably damaging 1.00
R2418:Magi1 UTSW 6 93745910 missense probably damaging 1.00
R3076:Magi1 UTSW 6 93757687 missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93699629 missense probably damaging 0.98
R4005:Magi1 UTSW 6 93701318 missense probably damaging 1.00
R4455:Magi1 UTSW 6 93785457 missense probably damaging 1.00
R4670:Magi1 UTSW 6 93686643 splice site probably null
R4671:Magi1 UTSW 6 93680787 critical splice donor site probably null
R4839:Magi1 UTSW 6 93694196 missense probably damaging 1.00
R5132:Magi1 UTSW 6 93683091 critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93747267 missense probably damaging 1.00
R5525:Magi1 UTSW 6 93792373 missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93680871 missense probably benign 0.03
R5724:Magi1 UTSW 6 93745701 missense probably damaging 1.00
R5846:Magi1 UTSW 6 93685603 missense probably damaging 1.00
R5896:Magi1 UTSW 6 93708199 missense probably damaging 1.00
R5912:Magi1 UTSW 6 93708145 missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93745590 missense probably damaging 1.00
R6115:Magi1 UTSW 6 93708070 missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93943229 missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94283196 missense probably benign 0.06
R6457:Magi1 UTSW 6 93699639 missense probably damaging 1.00
R6464:Magi1 UTSW 6 93699789 missense probably damaging 1.00
R6613:Magi1 UTSW 6 93745673 missense probably damaging 1.00
R6661:Magi1 UTSW 6 93943308 missense probably benign 0.08
R6755:Magi1 UTSW 6 93708177 missense probably damaging 1.00
R6909:Magi1 UTSW 6 93697320 missense probably damaging 1.00
R7180:Magi1 UTSW 6 93815750 missense probably benign 0.10
R7447:Magi1 UTSW 6 93745581 missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93708208 missense probably damaging 0.99
R7537:Magi1 UTSW 6 93708110 nonsense probably null
R7549:Magi1 UTSW 6 93708114 missense probably benign 0.19
R7566:Magi1 UTSW 6 93678327 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGAGACAAGCTCATGGAGTC -3'
(R):5'- AGCTCACATTCTCCTGGTAGC -3'

Sequencing Primer
(F):5'- CATGGAGTCATGCCAGGG -3'
(R):5'- ACGTACTACTTGTATAGCATGCC -3'
Posted On2019-06-26