Mutagenetix > Incidental Mutation

Incidental Mutation 'R7224:Atp10a'

562025

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

045296-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R7224 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58797471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 654 (M654L)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

AlphaFold

O54827

Predicted Effect

probably benign
Transcript: ENSMUST00000168747
AA Change: M654L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: M654L

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	G	8: 84,172,213	T577A	probably benign	Het
Aadac	C	T	3: 60,035,854	T60M	probably benign	Het
Actn4	C	T	7: 28,962,084	A34T	probably benign	Het
Acvrl1	A	G	15: 101,143,364	M466V	probably benign	Het
Adamts7	T	C	9: 90,185,815	Y453H	probably damaging	Het
Amfr	G	A	8: 93,984,856	P351S	probably damaging	Het
Ankrd26	G	A	6: 118,539,727	T492M	probably benign	Het
Anxa6	A	G	11: 54,986,167	F547L	probably damaging	Het
Ap5m1	T	G	14: 49,080,927	Y394D	unknown	Het
Atic	G	A	1: 71,570,855	V342I	probably benign	Het
Atl1	C	A	12: 69,955,353	T362N	probably benign	Het
B3gnt5	A	T	16: 19,769,753	M241L	probably benign	Het
Bbs7	A	G	3: 36,605,728	V186A	possibly damaging	Het
C8b	T	C	4: 104,780,598	L89P	probably damaging	Het
Capn7	G	T	14: 31,370,721	E742*	probably null	Het
Ccdc162	G	A	10: 41,561,191	R1741C	probably damaging	Het
Chsy3	T	A	18: 59,408,975	L395H	probably damaging	Het
Cnot9	A	G	1: 74,517,229	T62A	probably benign	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Cyp2d12	T	A	15: 82,557,648		probably null	Het
Dnah7a	A	G	1: 53,397,261	V3974A	probably benign	Het
Dync1h1	G	A	12: 110,617,762	G533D	possibly damaging	Het
Elfn1	A	G	5: 139,972,473	S411G	probably benign	Het
Enpp3	T	C	10: 24,776,884	D725G	possibly damaging	Het
Epp13	T	G	7: 6,268,802	M77R	probably benign	Het
Fmnl1	T	C	11: 103,182,769		probably null	Het
Fndc8	T	C	11: 82,892,325	M44T	probably benign	Het
Gcgr	A	T	11: 120,534,712		probably benign	Het
Ggt1	T	A	10: 75,574,276	V14D	possibly damaging	Het
Gigyf2	A	G	1: 87,403,725	I198M	unknown	Het
Gm28710	T	C	5: 16,836,594	V615A	possibly damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm6034	T	A	17: 36,056,439	S59T	unknown	Het
Gm6408	G	A	5: 146,484,370	V270I	probably benign	Het
Gm853	C	G	4: 130,219,199	A135P	probably damaging	Het
Gpr20	A	T	15: 73,696,132	I136N	probably damaging	Het
Ide	T	C	19: 37,290,761	E565G		Het
Igsf9	T	C	1: 172,494,782	S515P	probably damaging	Het
Kbtbd12	G	A	6: 88,613,983	R416*	probably null	Het
Kcnd3	A	T	3: 105,669,084	I615F	probably damaging	Het
Kcnk7	A	T	19: 5,706,777	M265L	probably benign	Het
Klhdc1	G	A	12: 69,263,149	S275N	probably damaging	Het
Lrba	A	C	3: 86,395,246	N1871T	probably damaging	Het
Lrrk1	A	G	7: 66,332,386	V169A	probably damaging	Het
Magi1	A	G	6: 93,683,089	I1175T	probably benign	Het
Man1a2	T	C	3: 100,582,053	T537A	possibly damaging	Het
Mrpl17	T	C	7: 105,810,002	N129S	probably damaging	Het
Mup5	G	A	4: 61,832,385	R174C	probably damaging	Het
Ndufaf1	G	A	2: 119,658,396	R216C	probably damaging	Het
Neb	T	C	2: 52,334,659		probably null	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr553	A	T	7: 102,614,767	M74K	probably damaging	Het
Olfr76	T	C	19: 12,120,548	T55A	probably benign	Het
Olfr875	G	A	9: 37,773,415	G252D	possibly damaging	Het
Osbpl8	C	T	10: 111,275,011	P458L	possibly damaging	Het
Pcdh20	T	C	14: 88,469,075	E263G	possibly damaging	Het
Pkd1l1	A	G	11: 8,945,241	L623P		Het
Plxdc1	T	C	11: 97,932,327	T363A	possibly damaging	Het
Pole3	T	C	4: 62,524,050	D111G	unknown	Het
R3hdm2	T	A	10: 127,458,153	L172Q	probably damaging	Het
Rbm33	T	C	5: 28,394,324	V90A		Het
Rcbtb1	C	G	14: 59,228,379	I390M	probably damaging	Het
Romo1	G	A	2: 156,144,375		probably benign	Het
Sars	A	G	3: 108,428,203	Y410H	probably damaging	Het
Sesn2	T	C	4: 132,497,413	T327A	probably benign	Het
Slc30a5	A	G	13: 100,809,254	V530A	probably damaging	Het
Slc30a9	G	A	5: 67,315,701	E43K	probably benign	Het
Slc38a2	A	C	15: 96,691,359	L418W	probably damaging	Het
Snx14	T	C	9: 88,394,561	E557G	possibly damaging	Het
Spata33	T	A	8: 123,221,998	I123K	probably damaging	Het
Tdrd3	A	T	14: 87,477,403	H170L	probably damaging	Het
Trpm1	A	G	7: 64,219,106		probably null	Het
Tsr3	A	T	17: 25,242,595	E302D	probably benign	Het
Ttll11	A	G	2: 35,902,673	I386T	probably damaging	Het
Usp2	C	T	9: 44,075,969	T188M	possibly damaging	Het
Usp44	A	G	10: 93,845,993	I102V	probably benign	Het
Wasf1	A	G	10: 40,926,550	N67S	probably benign	Het
Zfp445	T	C	9: 122,852,143	N911S	probably benign	Het
Zfp467	A	G	6: 48,444,969		probably null	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
R9736:Atp10a	UTSW	7	58824330	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCCATTACAGGTGAGGGTG -3'
(R):5'- ATAGGCTCTGGCTGCATACAC -3'

Sequencing Primer
(F):5'- GAGGTTTGAGCTGAAGTCCCCAG -3'
(R):5'- TCTGGCTGCATACACCAGTG -3'

Posted On

2019-06-26