Mutagenetix > Incidental Mutations

Incidental Mutation 'R7224:Trpm1'

562026

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7224 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 64219106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably null
Transcript: ENSMUST00000085222

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000085222

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

probably null
Transcript: ENSMUST00000205994

Predicted Effect

probably null
Transcript: ENSMUST00000205994

Predicted Effect

probably null
Transcript: ENSMUST00000206263

Predicted Effect

probably null
Transcript: ENSMUST00000206263

Predicted Effect

probably null
Transcript: ENSMUST00000206277

Predicted Effect

probably null
Transcript: ENSMUST00000206277

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	G	8: 84,172,213	T577A	probably benign	Het
Aadac	C	T	3: 60,035,854	T60M	probably benign	Het
Actn4	C	T	7: 28,962,084	A34T	probably benign	Het
Acvrl1	A	G	15: 101,143,364	M466V	probably benign	Het
Adamts7	T	C	9: 90,185,815	Y453H	probably damaging	Het
Amfr	G	A	8: 93,984,856	P351S	probably damaging	Het
Ankrd26	G	A	6: 118,539,727	T492M	probably benign	Het
Anxa6	A	G	11: 54,986,167	F547L	probably damaging	Het
Ap5m1	T	G	14: 49,080,927	Y394D	unknown	Het
Atic	G	A	1: 71,570,855	V342I	probably benign	Het
Atl1	C	A	12: 69,955,353	T362N	probably benign	Het
Atp10a	A	T	7: 58,797,471	M654L	probably benign	Het
B3gnt5	A	T	16: 19,769,753	M241L	probably benign	Het
Bbs7	A	G	3: 36,605,728	V186A	possibly damaging	Het
C8b	T	C	4: 104,780,598	L89P	probably damaging	Het
Capn7	G	T	14: 31,370,721	E742*	probably null	Het
Ccdc162	G	A	10: 41,561,191	R1741C	probably damaging	Het
Chsy3	T	A	18: 59,408,975	L395H	probably damaging	Het
Cnot9	A	G	1: 74,517,229	T62A	probably benign	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Cyp2d12	T	A	15: 82,557,648		probably null	Het
Dnah7a	A	G	1: 53,397,261	V3974A	probably benign	Het
Dync1h1	G	A	12: 110,617,762	G533D	possibly damaging	Het
Elfn1	A	G	5: 139,972,473	S411G	probably benign	Het
Enpp3	T	C	10: 24,776,884	D725G	possibly damaging	Het
Epp13	T	G	7: 6,268,802	M77R	probably benign	Het
Fmnl1	T	C	11: 103,182,769		probably null	Het
Fndc8	T	C	11: 82,892,325	M44T	probably benign	Het
Gcgr	A	T	11: 120,534,712		probably benign	Het
Ggt1	T	A	10: 75,574,276	V14D	possibly damaging	Het
Gigyf2	A	G	1: 87,403,725	I198M	unknown	Het
Gm28710	T	C	5: 16,836,594	V615A	possibly damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm6034	T	A	17: 36,056,439	S59T	unknown	Het
Gm6408	G	A	5: 146,484,370	V270I	probably benign	Het
Gm853	C	G	4: 130,219,199	A135P	probably damaging	Het
Gpr20	A	T	15: 73,696,132	I136N	probably damaging	Het
Ide	T	C	19: 37,290,761	E565G		Het
Igsf9	T	C	1: 172,494,782	S515P	probably damaging	Het
Kbtbd12	G	A	6: 88,613,983	R416*	probably null	Het
Kcnd3	A	T	3: 105,669,084	I615F	probably damaging	Het
Kcnk7	A	T	19: 5,706,777	M265L	probably benign	Het
Klhdc1	G	A	12: 69,263,149	S275N	probably damaging	Het
Lrba	A	C	3: 86,395,246	N1871T	probably damaging	Het
Lrrk1	A	G	7: 66,332,386	V169A	probably damaging	Het
Magi1	A	G	6: 93,683,089	I1175T	probably benign	Het
Man1a2	T	C	3: 100,582,053	T537A	possibly damaging	Het
Mrpl17	T	C	7: 105,810,002	N129S	probably damaging	Het
Mup5	G	A	4: 61,832,385	R174C	probably damaging	Het
Ndufaf1	G	A	2: 119,658,396	R216C	probably damaging	Het
Neb	T	C	2: 52,334,659		probably null	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr553	A	T	7: 102,614,767	M74K	probably damaging	Het
Olfr76	T	C	19: 12,120,548	T55A	probably benign	Het
Olfr875	G	A	9: 37,773,415	G252D	possibly damaging	Het
Osbpl8	C	T	10: 111,275,011	P458L	possibly damaging	Het
Pcdh20	T	C	14: 88,469,075	E263G	possibly damaging	Het
Pkd1l1	A	G	11: 8,945,241	L623P		Het
Plxdc1	T	C	11: 97,932,327	T363A	possibly damaging	Het
Pole3	T	C	4: 62,524,050	D111G	unknown	Het
R3hdm2	T	A	10: 127,458,153	L172Q	probably damaging	Het
Rbm33	T	C	5: 28,394,324	V90A		Het
Rcbtb1	C	G	14: 59,228,379	I390M	probably damaging	Het
Romo1	G	A	2: 156,144,375		probably benign	Het
Sars	A	G	3: 108,428,203	Y410H	probably damaging	Het
Sesn2	T	C	4: 132,497,413	T327A	probably benign	Het
Slc30a5	A	G	13: 100,809,254	V530A	probably damaging	Het
Slc30a9	G	A	5: 67,315,701	E43K	probably benign	Het
Slc38a2	A	C	15: 96,691,359	L418W	probably damaging	Het
Snx14	T	C	9: 88,394,561	E557G	possibly damaging	Het
Spata33	T	A	8: 123,221,998	I123K	probably damaging	Het
Tdrd3	A	T	14: 87,477,403	H170L	probably damaging	Het
Tsr3	A	T	17: 25,242,595	E302D	probably benign	Het
Ttll11	A	G	2: 35,902,673	I386T	probably damaging	Het
Usp2	C	T	9: 44,075,969	T188M	possibly damaging	Het
Usp44	A	G	10: 93,845,993	I102V	probably benign	Het
Wasf1	A	G	10: 40,926,550	N67S	probably benign	Het
Zfp445	T	C	9: 122,852,143	N911S	probably benign	Het
Zfp467	A	G	6: 48,444,969		probably null	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CAGCTCTTGACAGTCATATGTGAG -3'
(R):5'- AGCATATTCGCGGTGCTAGC -3'

Sequencing Primer
(F):5'- GCCATGGGCTCAATTTCCAG -3'
(R):5'- GTGCTAGCTCGCCTCCAC -3'

Posted On

2019-06-26