Mutagenetix > Incidental Mutations

Incidental Mutation 'R7224:Adamts7'

562037

Institutional Source

Beutler Lab

Gene Symbol

Adamts7

Ensembl Gene

ENSMUSG00000032363

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7

Synonyms

ADAM-TS7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R7224 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90163069-90208071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90185815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 453 (Y453H)

Ref Sequence

ENSEMBL: ENSMUSP00000115972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]

AlphaFold

Q68SA9

Predicted Effect

probably damaging
Transcript: ENSMUST00000113059
AA Change: Y453H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: Y453H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	174	1.1e-36	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.3e-16	PFAM
Pfam:Reprolysin_4	224	425	8.5e-9	PFAM
Pfam:Reprolysin	226	437	2.2e-27	PFAM
Pfam:Reprolysin_2	244	427	2.9e-12	PFAM
Pfam:Reprolysin_3	248	383	5.2e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	2.2e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113060
AA Change: Y453H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: Y453H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	3.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.6e-16	PFAM
Pfam:Reprolysin_4	224	425	8.2e-9	PFAM
Pfam:Reprolysin	226	437	6.4e-30	PFAM
Pfam:Reprolysin_2	244	427	4.6e-12	PFAM
Pfam:Reprolysin_3	248	383	8.1e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.5e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1343	1393	2.4e-2	SMART
TSP1	1394	1451	1.8e-2	SMART
TSP1	1453	1500	4.82e-2	SMART
TSP1	1501	1558	1.39e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000134996
AA Change: Y453H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363
AA Change: Y453H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.4e-29	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	412	1e-17	PFAM
Pfam:Reprolysin_4	224	426	5e-10	PFAM
Pfam:Reprolysin	226	437	3.7e-31	PFAM
Pfam:Reprolysin_2	244	427	3.2e-13	PFAM
Pfam:Reprolysin_3	248	383	6.3e-14	PFAM
Blast:ACR	439	505	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000147250
AA Change: Y453H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: Y453H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.7e-26	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.4e-14	PFAM
Pfam:Reprolysin_4	224	425	7e-7	PFAM
Pfam:Reprolysin	226	437	4.9e-28	PFAM
Pfam:Reprolysin_2	244	427	5e-10	PFAM
Pfam:Reprolysin_3	248	383	6.5e-11	PFAM
ACR	439	515	1.7e-5	SMART
TSP1	526	578	2.3e-15	SMART
Pfam:ADAM_spacer1	683	794	3.5e-34	PFAM
TSP1	807	863	6.9e-9	SMART
TSP1	866	908	1.2e-3	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1284	1334	1.2e-4	SMART
TSP1	1335	1392	8.7e-5	SMART
TSP1	1394	1441	2.3e-4	SMART
TSP1	1442	1499	6.5e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167122
AA Change: Y453H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: Y453H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	1.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	7.2e-17	PFAM
Pfam:Reprolysin_4	224	425	3.6e-9	PFAM
Pfam:Reprolysin	226	437	2.9e-30	PFAM
Pfam:Reprolysin_2	244	427	2.2e-12	PFAM
Pfam:Reprolysin_3	248	383	3.7e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.1e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Meta Mutation Damage Score

0.4830

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	G	8: 84,172,213	T577A	probably benign	Het
Aadac	C	T	3: 60,035,854	T60M	probably benign	Het
Actn4	C	T	7: 28,962,084	A34T	probably benign	Het
Acvrl1	A	G	15: 101,143,364	M466V	probably benign	Het
Amfr	G	A	8: 93,984,856	P351S	probably damaging	Het
Ankrd26	G	A	6: 118,539,727	T492M	probably benign	Het
Anxa6	A	G	11: 54,986,167	F547L	probably damaging	Het
Ap5m1	T	G	14: 49,080,927	Y394D	unknown	Het
Atic	G	A	1: 71,570,855	V342I	probably benign	Het
Atl1	C	A	12: 69,955,353	T362N	probably benign	Het
Atp10a	A	T	7: 58,797,471	M654L	probably benign	Het
B3gnt5	A	T	16: 19,769,753	M241L	probably benign	Het
Bbs7	A	G	3: 36,605,728	V186A	possibly damaging	Het
C8b	T	C	4: 104,780,598	L89P	probably damaging	Het
Capn7	G	T	14: 31,370,721	E742*	probably null	Het
Ccdc162	G	A	10: 41,561,191	R1741C	probably damaging	Het
Chsy3	T	A	18: 59,408,975	L395H	probably damaging	Het
Cnot9	A	G	1: 74,517,229	T62A	probably benign	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Cyp2d12	T	A	15: 82,557,648		probably null	Het
Dnah7a	A	G	1: 53,397,261	V3974A	probably benign	Het
Dync1h1	G	A	12: 110,617,762	G533D	possibly damaging	Het
Elfn1	A	G	5: 139,972,473	S411G	probably benign	Het
Enpp3	T	C	10: 24,776,884	D725G	possibly damaging	Het
Epp13	T	G	7: 6,268,802	M77R	probably benign	Het
Fmnl1	T	C	11: 103,182,769		probably null	Het
Fndc8	T	C	11: 82,892,325	M44T	probably benign	Het
Gcgr	A	T	11: 120,534,712		probably benign	Het
Ggt1	T	A	10: 75,574,276	V14D	possibly damaging	Het
Gigyf2	A	G	1: 87,403,725	I198M	unknown	Het
Gm28710	T	C	5: 16,836,594	V615A	possibly damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm6034	T	A	17: 36,056,439	S59T	unknown	Het
Gm6408	G	A	5: 146,484,370	V270I	probably benign	Het
Gm853	C	G	4: 130,219,199	A135P	probably damaging	Het
Gpr20	A	T	15: 73,696,132	I136N	probably damaging	Het
Ide	T	C	19: 37,290,761	E565G		Het
Igsf9	T	C	1: 172,494,782	S515P	probably damaging	Het
Kbtbd12	G	A	6: 88,613,983	R416*	probably null	Het
Kcnd3	A	T	3: 105,669,084	I615F	probably damaging	Het
Kcnk7	A	T	19: 5,706,777	M265L	probably benign	Het
Klhdc1	G	A	12: 69,263,149	S275N	probably damaging	Het
Lrba	A	C	3: 86,395,246	N1871T	probably damaging	Het
Lrrk1	A	G	7: 66,332,386	V169A	probably damaging	Het
Magi1	A	G	6: 93,683,089	I1175T	probably benign	Het
Man1a2	T	C	3: 100,582,053	T537A	possibly damaging	Het
Mrpl17	T	C	7: 105,810,002	N129S	probably damaging	Het
Mup5	G	A	4: 61,832,385	R174C	probably damaging	Het
Ndufaf1	G	A	2: 119,658,396	R216C	probably damaging	Het
Neb	T	C	2: 52,334,659		probably null	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr553	A	T	7: 102,614,767	M74K	probably damaging	Het
Olfr76	T	C	19: 12,120,548	T55A	probably benign	Het
Olfr875	G	A	9: 37,773,415	G252D	possibly damaging	Het
Osbpl8	C	T	10: 111,275,011	P458L	possibly damaging	Het
Pcdh20	T	C	14: 88,469,075	E263G	possibly damaging	Het
Pkd1l1	A	G	11: 8,945,241	L623P		Het
Plxdc1	T	C	11: 97,932,327	T363A	possibly damaging	Het
Pole3	T	C	4: 62,524,050	D111G	unknown	Het
R3hdm2	T	A	10: 127,458,153	L172Q	probably damaging	Het
Rbm33	T	C	5: 28,394,324	V90A		Het
Rcbtb1	C	G	14: 59,228,379	I390M	probably damaging	Het
Romo1	G	A	2: 156,144,375		probably benign	Het
Sars	A	G	3: 108,428,203	Y410H	probably damaging	Het
Sesn2	T	C	4: 132,497,413	T327A	probably benign	Het
Slc30a5	A	G	13: 100,809,254	V530A	probably damaging	Het
Slc30a9	G	A	5: 67,315,701	E43K	probably benign	Het
Slc38a2	A	C	15: 96,691,359	L418W	probably damaging	Het
Snx14	T	C	9: 88,394,561	E557G	possibly damaging	Het
Spata33	T	A	8: 123,221,998	I123K	probably damaging	Het
Tdrd3	A	T	14: 87,477,403	H170L	probably damaging	Het
Trpm1	A	G	7: 64,219,106		probably null	Het
Tsr3	A	T	17: 25,242,595	E302D	probably benign	Het
Ttll11	A	G	2: 35,902,673	I386T	probably damaging	Het
Usp2	C	T	9: 44,075,969	T188M	possibly damaging	Het
Usp44	A	G	10: 93,845,993	I102V	probably benign	Het
Wasf1	A	G	10: 40,926,550	N67S	probably benign	Het
Zfp445	T	C	9: 122,852,143	N911S	probably benign	Het
Zfp467	A	G	6: 48,444,969		probably null	Het

Other mutations in Adamts7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Adamts7	APN	9	90194249	missense	possibly damaging	0.71
IGL00673:Adamts7	APN	9	90193661	missense	possibly damaging	0.78
IGL00902:Adamts7	APN	9	90188794	critical splice donor site	probably null
IGL01303:Adamts7	APN	9	90171734	missense	possibly damaging	0.46
IGL01333:Adamts7	APN	9	90186979	missense	probably damaging	1.00
IGL01431:Adamts7	APN	9	90207785	missense	possibly damaging	0.89
IGL01595:Adamts7	APN	9	90193306	missense	probably benign	0.02
IGL02728:Adamts7	APN	9	90191827	splice site	probably benign
IGL02860:Adamts7	APN	9	90191862	missense	probably benign
IGL03237:Adamts7	APN	9	90188664	missense	probably damaging	1.00
PIT4495001:Adamts7	UTSW	9	90174622	missense	probably damaging	1.00
R0044:Adamts7	UTSW	9	90171588	missense	possibly damaging	0.58
R0078:Adamts7	UTSW	9	90179411	missense	probably damaging	1.00
R0107:Adamts7	UTSW	9	90180720	missense	possibly damaging	0.82
R0122:Adamts7	UTSW	9	90179421	missense	probably damaging	1.00
R0166:Adamts7	UTSW	9	90193692	missense	probably benign	0.00
R0517:Adamts7	UTSW	9	90199858	missense	probably benign	0.01
R1442:Adamts7	UTSW	9	90188770	missense	probably damaging	0.99
R1468:Adamts7	UTSW	9	90188798	splice site	probably benign
R1554:Adamts7	UTSW	9	90173650	missense	probably damaging	1.00
R1612:Adamts7	UTSW	9	90188697	missense	possibly damaging	0.86
R1652:Adamts7	UTSW	9	90189644	missense	probably damaging	1.00
R2007:Adamts7	UTSW	9	90177856	missense	probably damaging	1.00
R2091:Adamts7	UTSW	9	90188440	critical splice donor site	probably null
R2202:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2204:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2205:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2305:Adamts7	UTSW	9	90180711	missense	probably benign	0.39
R2409:Adamts7	UTSW	9	90180687	missense	probably damaging	1.00
R4157:Adamts7	UTSW	9	90188361	missense	probably damaging	1.00
R4210:Adamts7	UTSW	9	90194010	missense	possibly damaging	0.95
R4368:Adamts7	UTSW	9	90195851	critical splice donor site	probably null
R4533:Adamts7	UTSW	9	90180708	missense	probably damaging	1.00
R4608:Adamts7	UTSW	9	90174540	missense	probably damaging	1.00
R4623:Adamts7	UTSW	9	90186462	missense	probably benign	0.17
R4661:Adamts7	UTSW	9	90193330	missense	probably benign	0.02
R4820:Adamts7	UTSW	9	90189686	missense	possibly damaging	0.62
R4942:Adamts7	UTSW	9	90163311	missense	probably benign
R4961:Adamts7	UTSW	9	90185740	missense	probably damaging	1.00
R5064:Adamts7	UTSW	9	90195830	missense	probably damaging	1.00
R5763:Adamts7	UTSW	9	90188409	missense	probably damaging	1.00
R5921:Adamts7	UTSW	9	90188694	missense	probably benign	0.20
R6027:Adamts7	UTSW	9	90191025	missense	probably damaging	1.00
R6182:Adamts7	UTSW	9	90192436	missense	probably benign	0.01
R6306:Adamts7	UTSW	9	90178278	critical splice donor site	probably null
R6404:Adamts7	UTSW	9	90180456	splice site	probably null
R6488:Adamts7	UTSW	9	90171482	missense	probably benign	0.00
R6649:Adamts7	UTSW	9	90191937	missense	probably damaging	1.00
R6658:Adamts7	UTSW	9	90195300	missense	probably damaging	0.99
R6874:Adamts7	UTSW	9	90188731	missense	probably damaging	1.00
R6947:Adamts7	UTSW	9	90191804	splice site	probably null
R7110:Adamts7	UTSW	9	90193964	missense	possibly damaging	0.92
R7239:Adamts7	UTSW	9	90186557	splice site	probably null
R7519:Adamts7	UTSW	9	90197079	missense	probably benign	0.22
R7608:Adamts7	UTSW	9	90173773	missense	possibly damaging	0.68
R7635:Adamts7	UTSW	9	90195245	missense	probably damaging	1.00
R7699:Adamts7	UTSW	9	90188739	missense	probably damaging	1.00
R8519:Adamts7	UTSW	9	90193557	nonsense	probably null
R8680:Adamts7	UTSW	9	90195268	missense	probably damaging	1.00
R8743:Adamts7	UTSW	9	90195243	missense	probably damaging	0.99
R8784:Adamts7	UTSW	9	90193865	missense	probably null	0.00
R8794:Adamts7	UTSW	9	90194186	nonsense	probably null
R8851:Adamts7	UTSW	9	90193110	missense	probably benign	0.00
R9025:Adamts7	UTSW	9	90185795	nonsense	probably null
R9038:Adamts7	UTSW	9	90174639	missense
R9101:Adamts7	UTSW	9	90189741	critical splice donor site	probably null
R9256:Adamts7	UTSW	9	90178165	missense	probably damaging	1.00
R9261:Adamts7	UTSW	9	90193344	missense	probably benign	0.01
R9385:Adamts7	UTSW	9	90195205	nonsense	probably null
X0028:Adamts7	UTSW	9	90178217	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CATTTTCTCACCAGGTTCACAAGTC -3'
(R):5'- CGGCCACAAGTCACATTAGG -3'

Sequencing Primer
(F):5'- ACCAGGTTCACAAGTCCTTCCTAG -3'
(R):5'- AGGTATTACCATGCCCCTTGAAGG -3'

Posted On

2019-06-26