Incidental Mutation 'R7224:Fndc8'
ID 562048
Institutional Source Beutler Lab
Gene Symbol Fndc8
Ensembl Gene ENSMUSG00000018844
Gene Name fibronectin type III domain containing 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 82892124-82900801 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82892325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 44 (M44T)
Ref Sequence ENSEMBL: ENSMUSP00000018988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018985] [ENSMUST00000018988] [ENSMUST00000021033] [ENSMUST00000092844] [ENSMUST00000100718] [ENSMUST00000135963] [ENSMUST00000146053]
AlphaFold Q9D2H8
Predicted Effect probably benign
Transcript: ENSMUST00000018985
SMART Domains Protein: ENSMUSP00000018985
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 2e-27 PDB
AAA 99 274 1.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018988
AA Change: M44T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844
AA Change: M44T

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021033
SMART Domains Protein: ENSMUSP00000021033
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 249 3e-15 PFAM
Pfam:AAA_25 69 200 2e-12 PFAM
Pfam:KaiC 82 148 1.4e-10 PFAM
Pfam:AAA_19 93 168 6.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092844
SMART Domains Protein: ENSMUSP00000090520
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 66 130 2.4e-7 PFAM
Pfam:KaiC 82 129 8e-8 PFAM
Pfam:Rad51 115 274 8.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100718
SMART Domains Protein: ENSMUSP00000098284
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 5e-30 PDB
SCOP:d1b22a_ 10 48 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135963
SMART Domains Protein: ENSMUSP00000122477
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 219 7e-18 PFAM
Pfam:AAA_25 69 226 2.6e-15 PFAM
Pfam:KaiC 82 216 5.7e-12 PFAM
Pfam:AAA_19 93 168 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146053
SMART Domains Protein: ENSMUSP00000117401
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 48 1e-13 PDB
SCOP:d1b22a_ 10 48 7e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Fndc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Fndc8 APN 11 82898603 missense probably damaging 1.00
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R1827:Fndc8 UTSW 11 82899529 missense probably damaging 0.97
R2179:Fndc8 UTSW 11 82898754 missense probably damaging 1.00
R4504:Fndc8 UTSW 11 82892400 missense probably benign 0.21
R5401:Fndc8 UTSW 11 82897850 missense possibly damaging 0.80
R5889:Fndc8 UTSW 11 82898729 missense probably damaging 0.99
R5960:Fndc8 UTSW 11 82897572 missense probably benign 0.15
R6793:Fndc8 UTSW 11 82897586 missense probably damaging 1.00
R6798:Fndc8 UTSW 11 82892391 missense probably benign
R7210:Fndc8 UTSW 11 82897866 missense probably damaging 0.99
R7341:Fndc8 UTSW 11 82898777 missense possibly damaging 0.81
R7576:Fndc8 UTSW 11 82897574 missense probably damaging 1.00
R8190:Fndc8 UTSW 11 82897860 missense probably damaging 1.00
R9030:Fndc8 UTSW 11 82898696 missense probably benign 0.03
R9399:Fndc8 UTSW 11 82897913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAATGAAGGGTGAGACC -3'
(R):5'- AAAACTGATGTGGGGCTCAG -3'

Sequencing Primer
(F):5'- AGGGTGAGACCTTTGCCTCAG -3'
(R):5'- CTCAGGGCGGGTGCATG -3'
Posted On 2019-06-26