Mutagenetix > Incidental Mutation

Incidental Mutation 'R7224:Slc30a5'

562055

Institutional Source

Beutler Lab

Gene Symbol

Slc30a5

Ensembl Gene

ENSMUSG00000021629

Gene Name

solute carrier family 30 (zinc transporter), member 5

Synonyms

Zntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5

MMRRC Submission

045296-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.752) question?

Stock #

R7224 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100802648-100833427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100809254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 530 (V530A)

Ref Sequence

ENSEMBL: ENSMUSP00000065764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]

AlphaFold

Q8R4H9

Predicted Effect

probably damaging
Transcript: ENSMUST00000067246
AA Change: V530A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: V530A

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
transmembrane domain	56	75	N/A	INTRINSIC
transmembrane domain	96	113	N/A	INTRINSIC
transmembrane domain	128	145	N/A	INTRINSIC
transmembrane domain	150	164	N/A	INTRINSIC
transmembrane domain	192	214	N/A	INTRINSIC
transmembrane domain	235	254	N/A	INTRINSIC
transmembrane domain	264	286	N/A	INTRINSIC
transmembrane domain	299	321	N/A	INTRINSIC
transmembrane domain	341	360	N/A	INTRINSIC
Pfam:Cation_efflux	417	645	1.9e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225086

Predicted Effect

probably damaging
Transcript: ENSMUST00000225922
AA Change: V473A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.5585

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	G	8: 84,172,213	T577A	probably benign	Het
Aadac	C	T	3: 60,035,854	T60M	probably benign	Het
Actn4	C	T	7: 28,962,084	A34T	probably benign	Het
Acvrl1	A	G	15: 101,143,364	M466V	probably benign	Het
Adamts7	T	C	9: 90,185,815	Y453H	probably damaging	Het
Amfr	G	A	8: 93,984,856	P351S	probably damaging	Het
Ankrd26	G	A	6: 118,539,727	T492M	probably benign	Het
Anxa6	A	G	11: 54,986,167	F547L	probably damaging	Het
Ap5m1	T	G	14: 49,080,927	Y394D	unknown	Het
Atic	G	A	1: 71,570,855	V342I	probably benign	Het
Atl1	C	A	12: 69,955,353	T362N	probably benign	Het
Atp10a	A	T	7: 58,797,471	M654L	probably benign	Het
B3gnt5	A	T	16: 19,769,753	M241L	probably benign	Het
Bbs7	A	G	3: 36,605,728	V186A	possibly damaging	Het
C8b	T	C	4: 104,780,598	L89P	probably damaging	Het
Capn7	G	T	14: 31,370,721	E742*	probably null	Het
Ccdc162	G	A	10: 41,561,191	R1741C	probably damaging	Het
Chsy3	T	A	18: 59,408,975	L395H	probably damaging	Het
Cnot9	A	G	1: 74,517,229	T62A	probably benign	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Cyp2d12	T	A	15: 82,557,648		probably null	Het
Dnah7a	A	G	1: 53,397,261	V3974A	probably benign	Het
Dync1h1	G	A	12: 110,617,762	G533D	possibly damaging	Het
Elfn1	A	G	5: 139,972,473	S411G	probably benign	Het
Enpp3	T	C	10: 24,776,884	D725G	possibly damaging	Het
Epp13	T	G	7: 6,268,802	M77R	probably benign	Het
Fmnl1	T	C	11: 103,182,769		probably null	Het
Fndc8	T	C	11: 82,892,325	M44T	probably benign	Het
Gcgr	A	T	11: 120,534,712		probably benign	Het
Ggt1	T	A	10: 75,574,276	V14D	possibly damaging	Het
Gigyf2	A	G	1: 87,403,725	I198M	unknown	Het
Gm28710	T	C	5: 16,836,594	V615A	possibly damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm6034	T	A	17: 36,056,439	S59T	unknown	Het
Gm6408	G	A	5: 146,484,370	V270I	probably benign	Het
Gm853	C	G	4: 130,219,199	A135P	probably damaging	Het
Gpr20	A	T	15: 73,696,132	I136N	probably damaging	Het
Ide	T	C	19: 37,290,761	E565G		Het
Igsf9	T	C	1: 172,494,782	S515P	probably damaging	Het
Kbtbd12	G	A	6: 88,613,983	R416*	probably null	Het
Kcnd3	A	T	3: 105,669,084	I615F	probably damaging	Het
Kcnk7	A	T	19: 5,706,777	M265L	probably benign	Het
Klhdc1	G	A	12: 69,263,149	S275N	probably damaging	Het
Lrba	A	C	3: 86,395,246	N1871T	probably damaging	Het
Lrrk1	A	G	7: 66,332,386	V169A	probably damaging	Het
Magi1	A	G	6: 93,683,089	I1175T	probably benign	Het
Man1a2	T	C	3: 100,582,053	T537A	possibly damaging	Het
Mrpl17	T	C	7: 105,810,002	N129S	probably damaging	Het
Mup5	G	A	4: 61,832,385	R174C	probably damaging	Het
Ndufaf1	G	A	2: 119,658,396	R216C	probably damaging	Het
Neb	T	C	2: 52,334,659		probably null	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr553	A	T	7: 102,614,767	M74K	probably damaging	Het
Olfr76	T	C	19: 12,120,548	T55A	probably benign	Het
Olfr875	G	A	9: 37,773,415	G252D	possibly damaging	Het
Osbpl8	C	T	10: 111,275,011	P458L	possibly damaging	Het
Pcdh20	T	C	14: 88,469,075	E263G	possibly damaging	Het
Pkd1l1	A	G	11: 8,945,241	L623P		Het
Plxdc1	T	C	11: 97,932,327	T363A	possibly damaging	Het
Pole3	T	C	4: 62,524,050	D111G	unknown	Het
R3hdm2	T	A	10: 127,458,153	L172Q	probably damaging	Het
Rbm33	T	C	5: 28,394,324	V90A		Het
Rcbtb1	C	G	14: 59,228,379	I390M	probably damaging	Het
Romo1	G	A	2: 156,144,375		probably benign	Het
Sars	A	G	3: 108,428,203	Y410H	probably damaging	Het
Sesn2	T	C	4: 132,497,413	T327A	probably benign	Het
Slc30a9	G	A	5: 67,315,701	E43K	probably benign	Het
Slc38a2	A	C	15: 96,691,359	L418W	probably damaging	Het
Snx14	T	C	9: 88,394,561	E557G	possibly damaging	Het
Spata33	T	A	8: 123,221,998	I123K	probably damaging	Het
Tdrd3	A	T	14: 87,477,403	H170L	probably damaging	Het
Trpm1	A	G	7: 64,219,106		probably null	Het
Tsr3	A	T	17: 25,242,595	E302D	probably benign	Het
Ttll11	A	G	2: 35,902,673	I386T	probably damaging	Het
Usp2	C	T	9: 44,075,969	T188M	possibly damaging	Het
Usp44	A	G	10: 93,845,993	I102V	probably benign	Het
Wasf1	A	G	10: 40,926,550	N67S	probably benign	Het
Zfp445	T	C	9: 122,852,143	N911S	probably benign	Het
Zfp467	A	G	6: 48,444,969		probably null	Het

Other mutations in Slc30a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Slc30a5	APN	13	100806666	missense	probably damaging	1.00
IGL01647:Slc30a5	APN	13	100821145	missense	possibly damaging	0.66
IGL02338:Slc30a5	APN	13	100803433	missense	probably damaging	0.99
IGL02408:Slc30a5	APN	13	100813724	missense	probably damaging	1.00
IGL02582:Slc30a5	APN	13	100812647	critical splice donor site	probably null
IGL02987:Slc30a5	APN	13	100803915	missense	probably damaging	1.00
IGL03025:Slc30a5	APN	13	100813887	missense	probably damaging	0.99
IGL03064:Slc30a5	APN	13	100811310	missense	probably damaging	1.00
IGL03089:Slc30a5	APN	13	100813830	missense	probably benign	0.01
IGL03268:Slc30a5	APN	13	100806703	missense	probably damaging	1.00
R0083:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0153:Slc30a5	UTSW	13	100826494	missense	possibly damaging	0.46
R0542:Slc30a5	UTSW	13	100809285	splice site	probably null
R0601:Slc30a5	UTSW	13	100814770	intron	probably benign
R1125:Slc30a5	UTSW	13	100803413	missense	probably damaging	1.00
R1434:Slc30a5	UTSW	13	100803442	missense	probably damaging	0.98
R1673:Slc30a5	UTSW	13	100813383	missense	probably benign	0.13
R1762:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R1974:Slc30a5	UTSW	13	100813953	missense	probably benign	0.06
R2082:Slc30a5	UTSW	13	100806533	critical splice donor site	probably null
R2151:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2152:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2153:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R3899:Slc30a5	UTSW	13	100818147	missense	probably benign	0.18
R4009:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4010:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4270:Slc30a5	UTSW	13	100829013	missense	probably benign	0.04
R4815:Slc30a5	UTSW	13	100813710	missense	probably damaging	1.00
R5048:Slc30a5	UTSW	13	100806741	missense	probably damaging	1.00
R5450:Slc30a5	UTSW	13	100821172	missense	possibly damaging	0.81
R5638:Slc30a5	UTSW	13	100813872	nonsense	probably null
R5892:Slc30a5	UTSW	13	100813302	missense	probably damaging	1.00
R5911:Slc30a5	UTSW	13	100809092	missense	probably damaging	1.00
R6453:Slc30a5	UTSW	13	100814689	missense	probably benign	0.00
R6769:Slc30a5	UTSW	13	100813860	missense	probably benign	0.19
R6795:Slc30a5	UTSW	13	100817069	missense	probably damaging	1.00
R7020:Slc30a5	UTSW	13	100824913	splice site	probably null
R7305:Slc30a5	UTSW	13	100811424	missense	probably damaging	0.98
R7318:Slc30a5	UTSW	13	100813969	missense	probably benign	0.13
R7411:Slc30a5	UTSW	13	100818180	missense	probably benign	0.15
R7563:Slc30a5	UTSW	13	100803972	missense	probably benign	0.30
R8039:Slc30a5	UTSW	13	100813681	critical splice donor site	probably null
R8061:Slc30a5	UTSW	13	100828911	missense	probably damaging	0.99
R8973:Slc30a5	UTSW	13	100806694	missense	probably damaging	0.99
R9150:Slc30a5	UTSW	13	100803407	nonsense	probably null
R9352:Slc30a5	UTSW	13	100803872	missense	probably benign	0.10
R9359:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R9405:Slc30a5	UTSW	13	100813908	missense	probably benign	0.00
R9407:Slc30a5	UTSW	13	100814706	nonsense	probably null
R9628:Slc30a5	UTSW	13	100824914	critical splice donor site	probably null
X0019:Slc30a5	UTSW	13	100813842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACTCACCCCTCATGTTC -3'
(R):5'- GTACAGTTGGACCAAGGATGTG -3'

Sequencing Primer
(F):5'- ACCCCTCATGTTCGCATTCATG -3'
(R):5'- CTAGGTAGCCCTGGAATTCACAG -3'

Posted On

2019-06-26