Incidental Mutation 'R0575:Olfr1461'
ID56206
Institutional Source Beutler Lab
Gene Symbol Olfr1461
Ensembl Gene ENSMUSG00000045883
Gene Nameolfactory receptor 1461
SynonymsGA_x6K02T2RE5P-3491834-3492772, MOR202-35
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0575 (G1)
Quality Score174
Status Validated
Chromosome19
Chromosomal Location13163000-13168130 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13165387 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 124 (Y124*)
Ref Sequence ENSEMBL: ENSMUSP00000146723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053772] [ENSMUST00000207113] [ENSMUST00000208489]
Predicted Effect probably null
Transcript: ENSMUST00000053772
AA Change: Y124*
SMART Domains Protein: ENSMUSP00000053269
Gene: ENSMUSG00000045883
AA Change: Y124*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 6e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 8e-6 PFAM
Pfam:7tm_1 42 291 2e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207113
AA Change: Y124*
Predicted Effect probably null
Transcript: ENSMUST00000208489
AA Change: Y124*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Olfr1461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1461 APN 19 13165371 missense probably damaging 1.00
IGL01370:Olfr1461 APN 19 13165299 missense possibly damaging 0.95
IGL01936:Olfr1461 APN 19 13165403 missense probably damaging 1.00
R0098:Olfr1461 UTSW 19 13165662 missense probably benign 0.12
R0270:Olfr1461 UTSW 19 13165887 missense probably damaging 1.00
R0627:Olfr1461 UTSW 19 13165250 missense probably benign 0.43
R1779:Olfr1461 UTSW 19 13165040 missense probably benign 0.00
R1956:Olfr1461 UTSW 19 13165196 missense probably damaging 1.00
R2446:Olfr1461 UTSW 19 13165447 missense probably benign 0.00
R3622:Olfr1461 UTSW 19 13165656 missense probably benign 0.06
R4485:Olfr1461 UTSW 19 13165491 missense possibly damaging 0.54
R4605:Olfr1461 UTSW 19 13165248 missense probably damaging 1.00
R4757:Olfr1461 UTSW 19 13165913 missense probably benign 0.01
R4816:Olfr1461 UTSW 19 13165124 missense probably benign 0.10
R5038:Olfr1461 UTSW 19 13165591 missense probably benign 0.39
R7026:Olfr1461 UTSW 19 13165415 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACATCATCACCCTGGTAGGGAACC -3'
(R):5'- CACAGGTGGAAAGAGCCTTCTGAAC -3'

Sequencing Primer
(F):5'- AACCTGGGGATGATCCTGC -3'
(R):5'- GGAAAGAGCCTTCTGAACTCCTG -3'
Posted On2013-07-11