Incidental Mutation 'R7224:Pcdh20'
ID 562060
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Name protocadherin 20
Synonyms C630015B17Rik, PCDH13
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 88464743-88471396 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88469075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 263 (E263G)
Ref Sequence ENSEMBL: ENSMUSP00000054774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
AlphaFold Q8BIZ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000061628
AA Change: E263G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: E263G

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192557
AA Change: E263G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: E263G

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88467881 missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88467200 missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88470908 missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88469595 missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88468844 missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88467002 utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88467308 missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88468947 missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88469003 missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88468668 missense probably benign
R0575:Pcdh20 UTSW 14 88467612 missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88468790 missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88468301 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88468322 missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88467974 missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88469184 missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88468704 missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88467155 missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88467548 missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88467236 missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88468463 missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88468179 missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88468998 missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88468430 missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88467616 missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88467668 missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88469726 missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88468915 missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88468377 missense probably benign
R5652:Pcdh20 UTSW 14 88467324 missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88470876 missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88467254 missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88468602 missense probably benign
R7044:Pcdh20 UTSW 14 88469171 missense probably damaging 0.98
R7388:Pcdh20 UTSW 14 88468667 missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88468614 missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88469153 missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88469367 missense probably benign
R7706:Pcdh20 UTSW 14 88467357 missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7892:Pcdh20 UTSW 14 88467431 nonsense probably null
R8218:Pcdh20 UTSW 14 88468611 missense probably damaging 0.96
R8545:Pcdh20 UTSW 14 88469165 missense probably damaging 0.96
R8701:Pcdh20 UTSW 14 88468413 missense possibly damaging 0.95
R9219:Pcdh20 UTSW 14 88468819 missense probably benign 0.01
R9238:Pcdh20 UTSW 14 88468754 missense probably benign 0.43
R9418:Pcdh20 UTSW 14 88468019 missense probably benign
X0028:Pcdh20 UTSW 14 88467617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGCATTCCCATAAACGGTG -3'
(R):5'- GATATCAATGACAATGCTCCGC -3'

Sequencing Primer
(F):5'- ACGGTGACATTAATTTGTGAGTC -3'
(R):5'- ATGACAATGCTCCGCAGTTC -3'
Posted On 2019-06-26