Incidental Mutation 'R7224:B3gnt5'
ID 562064
Institutional Source Beutler Lab
Gene Symbol B3gnt5
Ensembl Gene ENSMUSG00000022686
Gene Name UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 19760208-19772753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19769753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 241 (M241L)
Ref Sequence ENSEMBL: ENSMUSP00000078712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]
AlphaFold Q8BGY6
Predicted Effect probably benign
Transcript: ENSMUST00000079780
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: M241L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119468
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: M241L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121344
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: M241L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164397
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: M241L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in B3gnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:B3gnt5 APN 16 19769213 missense probably damaging 1.00
IGL01503:B3gnt5 APN 16 19769781 missense probably damaging 1.00
IGL02623:B3gnt5 APN 16 19769610 missense probably damaging 1.00
IGL02978:B3gnt5 APN 16 19769994 missense probably damaging 1.00
IGL03355:B3gnt5 APN 16 19769153 missense probably benign 0.01
IGL03388:B3gnt5 APN 16 19770051 missense possibly damaging 0.83
R0180:B3gnt5 UTSW 16 19769100 missense possibly damaging 0.48
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0974:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R1034:B3gnt5 UTSW 16 19769484 missense probably damaging 1.00
R1435:B3gnt5 UTSW 16 19769174 missense probably damaging 0.99
R1480:B3gnt5 UTSW 16 19769867 missense probably damaging 1.00
R1533:B3gnt5 UTSW 16 19769614 missense probably damaging 1.00
R1920:B3gnt5 UTSW 16 19769544 missense probably benign 0.34
R3962:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R3963:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R4620:B3gnt5 UTSW 16 19769882 missense probably benign 0.37
R4948:B3gnt5 UTSW 16 19769144 missense probably benign
R4987:B3gnt5 UTSW 16 19769202 missense probably damaging 1.00
R5027:B3gnt5 UTSW 16 19769694 missense probably damaging 1.00
R6415:B3gnt5 UTSW 16 19770009 missense probably damaging 1.00
R7027:B3gnt5 UTSW 16 19769990 missense probably damaging 1.00
R7261:B3gnt5 UTSW 16 19769373 missense probably damaging 1.00
R7369:B3gnt5 UTSW 16 19769660 missense probably benign 0.00
R8818:B3gnt5 UTSW 16 19769597 missense possibly damaging 0.53
Z1176:B3gnt5 UTSW 16 19769810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCAAATTCCTGATGACTGC -3'
(R):5'- CATCTTTTCATAGATGCAGGGGTG -3'

Sequencing Primer
(F):5'- GCCAAATTCCTGATGACTGCTGATG -3'
(R):5'- CCCAGAGAAAAATACATGGTCCTGTG -3'
Posted On 2019-06-26