Mutagenetix > Incidental Mutation

Incidental Mutation 'R7224:B3gnt5'

562064

Institutional Source

Beutler Lab

Gene Symbol

B3gnt5

Ensembl Gene

ENSMUSG00000022686

Gene Name

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5

Synonyms

MMRRC Submission

045296-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R7224 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19760208-19772753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19769753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 241 (M241L)

Ref Sequence

ENSEMBL: ENSMUSP00000078712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]

AlphaFold

Q8BGY6

Predicted Effect

probably benign
Transcript: ENSMUST00000079780
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: M241L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119468
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: M241L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121344
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: M241L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164397
AA Change: M241L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: M241L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	G	8: 84,172,213	T577A	probably benign	Het
Aadac	C	T	3: 60,035,854	T60M	probably benign	Het
Actn4	C	T	7: 28,962,084	A34T	probably benign	Het
Acvrl1	A	G	15: 101,143,364	M466V	probably benign	Het
Adamts7	T	C	9: 90,185,815	Y453H	probably damaging	Het
Amfr	G	A	8: 93,984,856	P351S	probably damaging	Het
Ankrd26	G	A	6: 118,539,727	T492M	probably benign	Het
Anxa6	A	G	11: 54,986,167	F547L	probably damaging	Het
Ap5m1	T	G	14: 49,080,927	Y394D	unknown	Het
Atic	G	A	1: 71,570,855	V342I	probably benign	Het
Atl1	C	A	12: 69,955,353	T362N	probably benign	Het
Atp10a	A	T	7: 58,797,471	M654L	probably benign	Het
Bbs7	A	G	3: 36,605,728	V186A	possibly damaging	Het
C8b	T	C	4: 104,780,598	L89P	probably damaging	Het
Capn7	G	T	14: 31,370,721	E742*	probably null	Het
Ccdc162	G	A	10: 41,561,191	R1741C	probably damaging	Het
Chsy3	T	A	18: 59,408,975	L395H	probably damaging	Het
Cnot9	A	G	1: 74,517,229	T62A	probably benign	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Cyp2d12	T	A	15: 82,557,648		probably null	Het
Dnah7a	A	G	1: 53,397,261	V3974A	probably benign	Het
Dync1h1	G	A	12: 110,617,762	G533D	possibly damaging	Het
Elfn1	A	G	5: 139,972,473	S411G	probably benign	Het
Enpp3	T	C	10: 24,776,884	D725G	possibly damaging	Het
Epp13	T	G	7: 6,268,802	M77R	probably benign	Het
Fmnl1	T	C	11: 103,182,769		probably null	Het
Fndc8	T	C	11: 82,892,325	M44T	probably benign	Het
Gcgr	A	T	11: 120,534,712		probably benign	Het
Ggt1	T	A	10: 75,574,276	V14D	possibly damaging	Het
Gigyf2	A	G	1: 87,403,725	I198M	unknown	Het
Gm28710	T	C	5: 16,836,594	V615A	possibly damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm6034	T	A	17: 36,056,439	S59T	unknown	Het
Gm6408	G	A	5: 146,484,370	V270I	probably benign	Het
Gm853	C	G	4: 130,219,199	A135P	probably damaging	Het
Gpr20	A	T	15: 73,696,132	I136N	probably damaging	Het
Ide	T	C	19: 37,290,761	E565G		Het
Igsf9	T	C	1: 172,494,782	S515P	probably damaging	Het
Kbtbd12	G	A	6: 88,613,983	R416*	probably null	Het
Kcnd3	A	T	3: 105,669,084	I615F	probably damaging	Het
Kcnk7	A	T	19: 5,706,777	M265L	probably benign	Het
Klhdc1	G	A	12: 69,263,149	S275N	probably damaging	Het
Lrba	A	C	3: 86,395,246	N1871T	probably damaging	Het
Lrrk1	A	G	7: 66,332,386	V169A	probably damaging	Het
Magi1	A	G	6: 93,683,089	I1175T	probably benign	Het
Man1a2	T	C	3: 100,582,053	T537A	possibly damaging	Het
Mrpl17	T	C	7: 105,810,002	N129S	probably damaging	Het
Mup5	G	A	4: 61,832,385	R174C	probably damaging	Het
Ndufaf1	G	A	2: 119,658,396	R216C	probably damaging	Het
Neb	T	C	2: 52,334,659		probably null	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr553	A	T	7: 102,614,767	M74K	probably damaging	Het
Olfr76	T	C	19: 12,120,548	T55A	probably benign	Het
Olfr875	G	A	9: 37,773,415	G252D	possibly damaging	Het
Osbpl8	C	T	10: 111,275,011	P458L	possibly damaging	Het
Pcdh20	T	C	14: 88,469,075	E263G	possibly damaging	Het
Pkd1l1	A	G	11: 8,945,241	L623P		Het
Plxdc1	T	C	11: 97,932,327	T363A	possibly damaging	Het
Pole3	T	C	4: 62,524,050	D111G	unknown	Het
R3hdm2	T	A	10: 127,458,153	L172Q	probably damaging	Het
Rbm33	T	C	5: 28,394,324	V90A		Het
Rcbtb1	C	G	14: 59,228,379	I390M	probably damaging	Het
Romo1	G	A	2: 156,144,375		probably benign	Het
Sars	A	G	3: 108,428,203	Y410H	probably damaging	Het
Sesn2	T	C	4: 132,497,413	T327A	probably benign	Het
Slc30a5	A	G	13: 100,809,254	V530A	probably damaging	Het
Slc30a9	G	A	5: 67,315,701	E43K	probably benign	Het
Slc38a2	A	C	15: 96,691,359	L418W	probably damaging	Het
Snx14	T	C	9: 88,394,561	E557G	possibly damaging	Het
Spata33	T	A	8: 123,221,998	I123K	probably damaging	Het
Tdrd3	A	T	14: 87,477,403	H170L	probably damaging	Het
Trpm1	A	G	7: 64,219,106		probably null	Het
Tsr3	A	T	17: 25,242,595	E302D	probably benign	Het
Ttll11	A	G	2: 35,902,673	I386T	probably damaging	Het
Usp2	C	T	9: 44,075,969	T188M	possibly damaging	Het
Usp44	A	G	10: 93,845,993	I102V	probably benign	Het
Wasf1	A	G	10: 40,926,550	N67S	probably benign	Het
Zfp445	T	C	9: 122,852,143	N911S	probably benign	Het
Zfp467	A	G	6: 48,444,969		probably null	Het

Other mutations in B3gnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:B3gnt5	APN	16	19769213	missense	probably damaging	1.00
IGL01503:B3gnt5	APN	16	19769781	missense	probably damaging	1.00
IGL02623:B3gnt5	APN	16	19769610	missense	probably damaging	1.00
IGL02978:B3gnt5	APN	16	19769994	missense	probably damaging	1.00
IGL03355:B3gnt5	APN	16	19769153	missense	probably benign	0.01
IGL03388:B3gnt5	APN	16	19770051	missense	possibly damaging	0.83
R0180:B3gnt5	UTSW	16	19769100	missense	possibly damaging	0.48
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0974:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R1034:B3gnt5	UTSW	16	19769484	missense	probably damaging	1.00
R1435:B3gnt5	UTSW	16	19769174	missense	probably damaging	0.99
R1480:B3gnt5	UTSW	16	19769867	missense	probably damaging	1.00
R1533:B3gnt5	UTSW	16	19769614	missense	probably damaging	1.00
R1920:B3gnt5	UTSW	16	19769544	missense	probably benign	0.34
R3962:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R3963:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R4620:B3gnt5	UTSW	16	19769882	missense	probably benign	0.37
R4948:B3gnt5	UTSW	16	19769144	missense	probably benign
R4987:B3gnt5	UTSW	16	19769202	missense	probably damaging	1.00
R5027:B3gnt5	UTSW	16	19769694	missense	probably damaging	1.00
R6415:B3gnt5	UTSW	16	19770009	missense	probably damaging	1.00
R7027:B3gnt5	UTSW	16	19769990	missense	probably damaging	1.00
R7261:B3gnt5	UTSW	16	19769373	missense	probably damaging	1.00
R7369:B3gnt5	UTSW	16	19769660	missense	probably benign	0.00
R8818:B3gnt5	UTSW	16	19769597	missense	possibly damaging	0.53
Z1176:B3gnt5	UTSW	16	19769810	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCAAATTCCTGATGACTGC -3'
(R):5'- CATCTTTTCATAGATGCAGGGGTG -3'

Sequencing Primer
(F):5'- GCCAAATTCCTGATGACTGCTGATG -3'
(R):5'- CCCAGAGAAAAATACATGGTCCTGTG -3'

Posted On

2019-06-26