Incidental Mutation 'R7224:Chsy3'
ID 562067
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Name chondroitin sulfate synthase 3
Synonyms 4833446K15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 59175401-59410446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59408975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 395 (L395H)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
AlphaFold Q5DTK1
Predicted Effect probably damaging
Transcript: ENSMUST00000080721
AA Change: L395H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: L395H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
inferior UTSW 18 59176415 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R2146:Chsy3 UTSW 18 59176472 missense probably benign 0.04
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3811:Chsy3 UTSW 18 59176170 missense probably benign 0.42
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409575 missense probably benign 0.07
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7046:Chsy3 UTSW 18 59409803 missense probably benign 0.00
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7860:Chsy3 UTSW 18 59409227 missense probably benign 0.10
R7936:Chsy3 UTSW 18 59409346 missense probably damaging 1.00
R8010:Chsy3 UTSW 18 59410154 missense probably damaging 1.00
R8029:Chsy3 UTSW 18 59179447 missense possibly damaging 0.87
R8215:Chsy3 UTSW 18 59175869 nonsense probably null
R8332:Chsy3 UTSW 18 59409015 missense probably damaging 0.98
R8375:Chsy3 UTSW 18 59179513 missense probably damaging 1.00
R8560:Chsy3 UTSW 18 59410058 missense possibly damaging 0.91
R8700:Chsy3 UTSW 18 59176415 missense probably damaging 1.00
R9040:Chsy3 UTSW 18 59409688 missense probably damaging 0.98
R9290:Chsy3 UTSW 18 59409856 missense probably benign 0.00
R9413:Chsy3 UTSW 18 59176098 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AACGAAGTGCCACATTAGTTCG -3'
(R):5'- TGAGTAAAGCAGCTTCCCCG -3'

Sequencing Primer
(F):5'- CTTTTCAGATGCAGCAGC -3'
(R):5'- ATTTCTCTCCCGAGGCTGGAAG -3'
Posted On 2019-06-26