Incidental Mutation 'R7224:Kcnk7'
ID 562068
Institutional Source Beutler Lab
Gene Symbol Kcnk7
Ensembl Gene ENSMUSG00000024936
Gene Name potassium channel, subfamily K, member 7
Synonyms Knot, 2310014G03Rik, Mlk3, Kcnk8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5704367-5707101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5706777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 265 (M265L)
Ref Sequence ENSEMBL: ENSMUSP00000051278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000049295] [ENSMUST00000052448] [ENSMUST00000075606]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004156
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049295
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052448
AA Change: M265L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051278
Gene: ENSMUSG00000024936
AA Change: M265L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Ion_trans_2 67 145 3.2e-14 PFAM
Pfam:Ion_trans_2 175 261 8.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and behaviorally normal with no significant alterations in volatile anesthetic sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Kcnk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Kcnk7 APN 19 5706202 missense probably damaging 0.99
IGL02348:Kcnk7 APN 19 5706473 unclassified probably benign
IGL03159:Kcnk7 APN 19 5706088 missense probably damaging 1.00
R0025:Kcnk7 UTSW 19 5707014 makesense probably null
R0739:Kcnk7 UTSW 19 5704802 splice site probably null
R0855:Kcnk7 UTSW 19 5706075 missense probably benign 0.02
R1506:Kcnk7 UTSW 19 5706112 missense probably damaging 1.00
R1676:Kcnk7 UTSW 19 5706978 missense probably benign 0.02
R1716:Kcnk7 UTSW 19 5706831 missense probably damaging 1.00
R4619:Kcnk7 UTSW 19 5706435 missense probably benign 0.00
R4715:Kcnk7 UTSW 19 5706253 missense probably damaging 1.00
R5119:Kcnk7 UTSW 19 5706324 missense probably benign 0.00
R7018:Kcnk7 UTSW 19 5706132 missense probably damaging 1.00
R7136:Kcnk7 UTSW 19 5706076 missense probably benign 0.02
R8458:Kcnk7 UTSW 19 5704379 unclassified probably benign
R8832:Kcnk7 UTSW 19 5704708 missense probably damaging 0.96
R8848:Kcnk7 UTSW 19 5706715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGAACACTGGGAGCCATGTTG -3'
(R):5'- ACACGATCGAGCTGACTTCC -3'

Sequencing Primer
(F):5'- CCATGTTGAGAGTTTCAAGTAGTGCC -3'
(R):5'- GACTTCCTGTCGCCTGACTG -3'
Posted On 2019-06-26