Incidental Mutation 'R0575:Zfp518a'
ID56207
Institutional Source Beutler Lab
Gene Symbol Zfp518a
Ensembl Gene ENSMUSG00000049164
Gene Namezinc finger protein 518A
Synonyms6330417C12Rik, 2810401C22Rik, Zfp518
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R0575 (G1)
Quality Score181
Status Validated
Chromosome19
Chromosomal Location40894705-40917947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40912315 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 229 (H229Q)
Ref Sequence ENSEMBL: ENSMUSP00000055956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050092]
Predicted Effect probably damaging
Transcript: ENSMUST00000050092
AA Change: H229Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055956
Gene: ENSMUSG00000049164
AA Change: H229Q

DomainStartEndE-ValueType
ZnF_C2H2 121 146 1.38e2 SMART
ZnF_C2H2 152 174 4.98e-1 SMART
ZnF_C2H2 179 203 6.75e0 SMART
ZnF_C2H2 209 231 4.34e-1 SMART
ZnF_C2H2 236 258 1.33e-1 SMART
ZnF_C2H2 264 287 9.44e-2 SMART
low complexity region 308 319 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 544 563 N/A INTRINSIC
low complexity region 671 680 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1147 1164 N/A INTRINSIC
low complexity region 1417 1424 N/A INTRINSIC
ZnF_C2H2 1444 1466 1.33e1 SMART
Meta Mutation Damage Score 0.1310 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc finger protein family. The encoded protein contains five zinc fingers and is likely a nuclear transcriptional regulator. Numerous transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Other mutations in Zfp518a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Zfp518a APN 19 40913470 missense probably damaging 0.99
IGL00647:Zfp518a APN 19 40914686 missense probably damaging 1.00
IGL01468:Zfp518a APN 19 40916031 missense probably benign 0.25
IGL02079:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02080:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02437:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02466:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02470:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02471:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02472:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02500:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40915430 missense probably benign 0.05
IGL02546:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02547:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02561:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02568:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02583:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02584:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02586:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02589:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02614:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02732:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02961:Zfp518a APN 19 40915018 missense probably benign 0.44
IGL02985:Zfp518a APN 19 40913667 missense possibly damaging 0.92
R0137:Zfp518a UTSW 19 40915866 missense probably damaging 1.00
R0218:Zfp518a UTSW 19 40912628 missense probably benign 0.25
R0367:Zfp518a UTSW 19 40912221 missense probably damaging 1.00
R1418:Zfp518a UTSW 19 40914359 missense probably damaging 1.00
R1795:Zfp518a UTSW 19 40915556 missense probably benign 0.05
R1965:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R2076:Zfp518a UTSW 19 40914327 missense probably damaging 1.00
R3796:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3799:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3807:Zfp518a UTSW 19 40914797 missense possibly damaging 0.90
R3904:Zfp518a UTSW 19 40914920 nonsense probably null
R3959:Zfp518a UTSW 19 40912698 missense probably damaging 1.00
R4630:Zfp518a UTSW 19 40912979 nonsense probably null
R4662:Zfp518a UTSW 19 40911860 missense probably benign 0.01
R4844:Zfp518a UTSW 19 40914896 missense probably damaging 0.99
R4911:Zfp518a UTSW 19 40915528 missense probably benign 0.04
R4934:Zfp518a UTSW 19 40914263 missense probably benign 0.01
R4964:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R4966:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R5373:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5374:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5378:Zfp518a UTSW 19 40915856 missense probably damaging 1.00
R5509:Zfp518a UTSW 19 40915401 missense possibly damaging 0.60
R5891:Zfp518a UTSW 19 40912433 missense probably damaging 1.00
R6187:Zfp518a UTSW 19 40915446 missense probably benign 0.03
R6259:Zfp518a UTSW 19 40912781 missense probably benign 0.01
R6260:Zfp518a UTSW 19 40914123 missense probably benign 0.00
R6763:Zfp518a UTSW 19 40913748 missense probably damaging 1.00
R7419:Zfp518a UTSW 19 40913763 missense possibly damaging 0.94
R7448:Zfp518a UTSW 19 40914157 missense possibly damaging 0.70
R7719:Zfp518a UTSW 19 40912768 missense probably benign 0.01
R7753:Zfp518a UTSW 19 40915805 missense possibly damaging 0.47
X0028:Zfp518a UTSW 19 40914933 missense possibly damaging 0.61
X0065:Zfp518a UTSW 19 40914182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGAAACACTTTGAAATGTGGCATC -3'
(R):5'- GACGGGCTTATCACCATTCTCACAG -3'

Sequencing Primer
(F):5'- GTTTTTCAGCAAGTGACTTCCAG -3'
(R):5'- TCCAAAATGTCTTTGTTGGACC -3'
Posted On2013-07-11