Incidental Mutation 'R7225:Fer1l5'
ID562072
Institutional Source Beutler Lab
Gene Symbol Fer1l5
Ensembl Gene ENSMUSG00000037432
Gene Namefer-1-like 5 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36372291-36422110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36420952 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1893 (W1893R)
Ref Sequence ENSEMBL: ENSMUSP00000142130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]
Predicted Effect probably benign
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115011
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125304
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140452
SMART Domains Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
Pfam:C2 1 78 1.4e-5 PFAM
Blast:C2 148 209 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152088
SMART Domains Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
Pfam:Lectin_leg-like 1 76 1.3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179162
AA Change: W1893R

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432
AA Change: W1893R

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192969
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Fer1l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4151001:Fer1l5 UTSW 1 36411647 missense probably benign 0.27
R5580:Fer1l5 UTSW 1 36385458 nonsense probably null
R5848:Fer1l5 UTSW 1 36388935 missense probably benign 0.39
R5930:Fer1l5 UTSW 1 36385173 nonsense probably null
R6193:Fer1l5 UTSW 1 36409436 missense probably benign 0.20
R6195:Fer1l5 UTSW 1 36375286 splice site probably null
R6207:Fer1l5 UTSW 1 36385160 missense probably damaging 1.00
R6233:Fer1l5 UTSW 1 36375286 splice site probably null
R6349:Fer1l5 UTSW 1 36411274 missense probably damaging 0.96
R6478:Fer1l5 UTSW 1 36402531 missense probably damaging 1.00
R6514:Fer1l5 UTSW 1 36403616 missense probably benign 0.01
R6611:Fer1l5 UTSW 1 36406654 missense probably benign 0.01
R6634:Fer1l5 UTSW 1 36411385 missense probably damaging 0.99
R6733:Fer1l5 UTSW 1 36408672 critical splice donor site probably null
R6816:Fer1l5 UTSW 1 36406510 missense possibly damaging 0.60
R7316:Fer1l5 UTSW 1 36418116 missense probably benign 0.41
R7455:Fer1l5 UTSW 1 36388983 missense probably benign 0.00
R7473:Fer1l5 UTSW 1 36421608 missense possibly damaging 0.53
R7702:Fer1l5 UTSW 1 36420694 nonsense probably null
R7714:Fer1l5 UTSW 1 36401477 missense probably damaging 1.00
R7872:Fer1l5 UTSW 1 36421886 missense probably benign 0.00
R7881:Fer1l5 UTSW 1 36407036 missense not run
R7984:Fer1l5 UTSW 1 36408621 missense possibly damaging 0.68
R8326:Fer1l5 UTSW 1 36376760 missense probably benign 0.04
Z1176:Fer1l5 UTSW 1 36390563 nonsense probably null
Z1177:Fer1l5 UTSW 1 36409194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTGGATTTATCAGACATGCCC -3'
(R):5'- GGCCTGATTAGAGCTTCTCTC -3'

Sequencing Primer
(F):5'- ATCAGACATGCCCCTTCCGG -3'
(R):5'- CTCTGATAGCATCTCAAGAGTCATC -3'
Posted On2019-06-26