Mutagenetix > Incidental Mutation

Incidental Mutation 'R7225:Cdan1'

562077

Institutional Source

Beutler Lab

Gene Symbol

Cdan1

Ensembl Gene

ENSMUSG00000027284

Gene Name

congenital dyserythropoietic anemia, type I (human)

Synonyms

codanin-1, CDA-I, CDA1, 1500015A01Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120716154-120850128 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120724912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 783 (T783A)

Ref Sequence

ENSEMBL: ENSMUSP00000106329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]

AlphaFold

Q8CC12

Predicted Effect

probably benign
Transcript: ENSMUST00000110700
AA Change: T783A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: T783A

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	102	151	N/A	INTRINSIC
low complexity region	154	180	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	786	906	2.4e-48	PFAM
low complexity region	1157	1171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110701
AA Change: T783A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: T783A

Domain	Start	End	E-Value	Type
low complexity region	77	98	N/A	INTRINSIC
low complexity region	101	150	N/A	INTRINSIC
low complexity region	153	179	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	789	904	2.4e-41	PFAM
low complexity region	1164	1178	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154193

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Cdan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Cdan1	APN	2	120725985	missense	probably damaging	1.00
IGL01660:Cdan1	APN	2	120725653	missense	possibly damaging	0.63
IGL01930:Cdan1	APN	2	120726582	intron	probably benign
IGL02597:Cdan1	APN	2	120725239	missense	probably benign	0.08
IGL03025:Cdan1	APN	2	120730741	missense	probably damaging	1.00
IGL03130:Cdan1	APN	2	120727912	missense	possibly damaging	0.94
IGL03388:Cdan1	APN	2	120730511	utr 3 prime	probably benign
FR4737:Cdan1	UTSW	2	120724971	missense	probably damaging	0.96
R0001:Cdan1	UTSW	2	120723751	missense	probably benign	0.41
R0650:Cdan1	UTSW	2	120726045	missense	probably benign	0.00
R0781:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R0881:Cdan1	UTSW	2	120720985	missense	probably damaging	1.00
R1110:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R1345:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1370:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1503:Cdan1	UTSW	2	120729575	missense	probably damaging	1.00
R1579:Cdan1	UTSW	2	120730739	missense	probably damaging	0.98
R1664:Cdan1	UTSW	2	120720506	missense	probably damaging	0.99
R1749:Cdan1	UTSW	2	120729799	missense	probably damaging	0.96
R1765:Cdan1	UTSW	2	120720749	missense	probably damaging	1.00
R1806:Cdan1	UTSW	2	120731426	utr 3 prime	probably benign
R1856:Cdan1	UTSW	2	120724936	missense	probably benign
R2202:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2203:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2204:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120725632	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120731020	utr 3 prime	probably benign
R4060:Cdan1	UTSW	2	120725743	missense	probably benign	0.00
R4324:Cdan1	UTSW	2	120724979	missense	probably damaging	0.97
R4379:Cdan1	UTSW	2	120726618	missense	probably damaging	1.00
R4611:Cdan1	UTSW	2	120730720	missense	probably damaging	0.96
R4695:Cdan1	UTSW	2	120728383	missense	probably damaging	1.00
R4866:Cdan1	UTSW	2	120731447	utr 3 prime	probably benign
R5183:Cdan1	UTSW	2	120729580	missense	probably damaging	0.96
R5347:Cdan1	UTSW	2	120730065	missense	possibly damaging	0.95
R5789:Cdan1	UTSW	2	120729535	missense	probably benign	0.22
R5958:Cdan1	UTSW	2	120723902	missense	possibly damaging	0.80
R6608:Cdan1	UTSW	2	120726680	missense	possibly damaging	0.78
R7055:Cdan1	UTSW	2	120727861	missense	probably damaging	0.97
R7065:Cdan1	UTSW	2	120718921	missense	probably benign	0.00
R7238:Cdan1	UTSW	2	120730302	missense	probably benign
R7316:Cdan1	UTSW	2	120728332	critical splice donor site	probably null
R7325:Cdan1	UTSW	2	120724704	missense	probably benign	0.25
R7432:Cdan1	UTSW	2	120722755	missense	probably damaging	1.00
R7517:Cdan1	UTSW	2	120727924	missense	probably damaging	1.00
R7691:Cdan1	UTSW	2	120729567	missense	probably damaging	1.00
R8004:Cdan1	UTSW	2	120731443	missense	unknown
R8324:Cdan1	UTSW	2	120727325	missense	probably benign	0.07
R8465:Cdan1	UTSW	2	120728440	missense	possibly damaging	0.93
R8556:Cdan1	UTSW	2	120722990	missense	probably damaging	1.00
R8932:Cdan1	UTSW	2	120731087	nonsense	probably null
R9462:Cdan1	UTSW	2	120729579	missense	possibly damaging	0.87
R9718:Cdan1	UTSW	2	120724169	missense	probably damaging	1.00
X0050:Cdan1	UTSW	2	120724145	missense	probably benign	0.29
Z1088:Cdan1	UTSW	2	120730336	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTACCAATGTAGGGGCAACAGG -3'
(R):5'- CAGAAGAAACTTGCTTGACCC -3'

Sequencing Primer
(F):5'- CAGGTATATAACAGCTGCTGGTCC -3'
(R):5'- AAACTTGCTTGACCCGGGAC -3'

Posted On

2019-06-26