Incidental Mutation 'R0576:Prdm14'
ID56208
Institutional Source Beutler Lab
Gene Symbol Prdm14
Ensembl Gene ENSMUSG00000042414
Gene NamePR domain containing 14
Synonyms
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0576 (G1)
Quality Score209
Status Validated
Chromosome1
Chromosomal Location13113457-13127163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13125725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 37 (S37R)
Ref Sequence ENSEMBL: ENSMUSP00000044245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047577
AA Change: S37R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044245
Gene: ENSMUSG00000042414
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
SET 244 362 2.8e-11 SMART
low complexity region 373 389 N/A INTRINSIC
ZnF_C2H2 390 410 1.4e-1 SMART
ZnF_C2H2 422 445 5.3e-5 SMART
ZnF_C2H2 451 473 3.2e-7 SMART
ZnF_C2H2 479 501 1.4e-4 SMART
ZnF_C2H2 507 530 8.1e-5 SMART
ZnF_C2H2 536 558 4.6e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased primordial germ cell numbers, absent germ cells, and sterility in both males and females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Prdm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Prdm14 APN 1 13125439 missense probably benign 0.07
R0099:Prdm14 UTSW 1 13118945 missense probably damaging 0.96
R0243:Prdm14 UTSW 1 13122448 missense probably damaging 1.00
R0312:Prdm14 UTSW 1 13118807 missense probably damaging 1.00
R0781:Prdm14 UTSW 1 13114361 missense probably damaging 0.99
R0791:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0792:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0855:Prdm14 UTSW 1 13125537 missense probably benign 0.00
R0905:Prdm14 UTSW 1 13125438 missense probably benign 0.00
R1467:Prdm14 UTSW 1 13124532 splice site probably benign
R1747:Prdm14 UTSW 1 13122403 missense possibly damaging 0.83
R1771:Prdm14 UTSW 1 13118858 missense probably damaging 1.00
R2073:Prdm14 UTSW 1 13125730 missense possibly damaging 0.95
R2170:Prdm14 UTSW 1 13122460 missense probably damaging 1.00
R2432:Prdm14 UTSW 1 13125633 missense probably benign
R4948:Prdm14 UTSW 1 13122631 missense probably damaging 1.00
R6267:Prdm14 UTSW 1 13118936 missense probably damaging 1.00
R6902:Prdm14 UTSW 1 13122421 missense probably benign
R7452:Prdm14 UTSW 1 13125559 missense probably damaging 0.98
R8066:Prdm14 UTSW 1 13114316 missense probably benign 0.00
R8265:Prdm14 UTSW 1 13114394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACCAGGGCAGATTGTAGAGCG -3'
(R):5'- TTGGCGGGATCGAATTGGGAAC -3'

Sequencing Primer
(F):5'- CAGATTGTAGAGCGGCTCG -3'
(R):5'- CGAATTGGGAACTTTGTTCATTGAC -3'
Posted On2013-07-11