Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Gria2'

562081

Institutional Source

Beutler Lab

Gene Symbol

Gria2

Ensembl Gene

ENSMUSG00000033981

Gene Name

glutamate receptor, ionotropic, AMPA2 (alpha 2)

Synonyms

Glur2, Glur-2, GluR-B, GluA2, GluR2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R7225 (G1)

Quality Score

203.009

Status

Validated

Chromosome

Chromosomal Location

80681450-80802835 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 80802631 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]

Predicted Effect

probably benign
Transcript: ENSMUST00000075316

SMART Domains

Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	49	379	2.7e-58	PFAM
PBPe	415	790	3.75e-132	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107745

SMART Domains

Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	47	379	4.8e-53	PFAM
PBPe	415	790	8.16e-133	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192463

SMART Domains

Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	47	379	1.7e-51	PFAM
PBPe	415	770	1.2e-105	SMART
Lig_chan-Glu_bd	425	490	2.2e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Gria2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Gria2	APN	3	80710790	missense	probably benign	0.12
IGL00832:Gria2	APN	3	80707251	missense	probably damaging	1.00
IGL01086:Gria2	APN	3	80692381	missense	probably damaging	1.00
IGL01409:Gria2	APN	3	80707697	critical splice donor site	probably null
IGL01924:Gria2	APN	3	80710331	missense	probably benign	0.13
IGL01999:Gria2	APN	3	80732091	missense	probably damaging	1.00
IGL02355:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02362:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02389:Gria2	APN	3	80709422	missense	probably benign	0.14
IGL02444:Gria2	APN	3	80702553	missense	possibly damaging	0.65
IGL02532:Gria2	APN	3	80706999	missense	probably damaging	1.00
IGL02991:Gria2	UTSW	3	80707809	nonsense	probably null
R0015:Gria2	UTSW	3	80707767	missense	probably damaging	1.00
R0148:Gria2	UTSW	3	80707731	missense	probably damaging	1.00
R0201:Gria2	UTSW	3	80707838	missense	probably damaging	1.00
R0411:Gria2	UTSW	3	80710858	splice site	probably benign
R0551:Gria2	UTSW	3	80732026	splice site	probably benign
R0655:Gria2	UTSW	3	80732070	nonsense	probably null
R0866:Gria2	UTSW	3	80722024	splice site	probably benign
R1393:Gria2	UTSW	3	80707098	missense	probably damaging	1.00
R1458:Gria2	UTSW	3	80732045	missense	possibly damaging	0.71
R1563:Gria2	UTSW	3	80691397	missense	probably damaging	0.96
R1771:Gria2	UTSW	3	80692301	nonsense	probably null
R1775:Gria2	UTSW	3	80691338	missense	probably benign	0.09
R1902:Gria2	UTSW	3	80722108	missense	probably damaging	0.98
R1993:Gria2	UTSW	3	80802357	missense	probably benign
R1994:Gria2	UTSW	3	80802357	missense	probably benign
R1995:Gria2	UTSW	3	80802357	missense	probably benign
R2001:Gria2	UTSW	3	80710805	missense	probably benign	0.28
R2389:Gria2	UTSW	3	80702625	missense	probably damaging	1.00
R2520:Gria2	UTSW	3	80706962	missense	probably damaging	1.00
R2679:Gria2	UTSW	3	80740953	splice site	probably benign
R2865:Gria2	UTSW	3	80732085	missense	probably benign	0.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R3716:Gria2	UTSW	3	80741004	missense	possibly damaging	0.77
R3967:Gria2	UTSW	3	80710777	missense	possibly damaging	0.95
R4285:Gria2	UTSW	3	80707662	intron	probably benign
R4611:Gria2	UTSW	3	80692492	missense	probably damaging	0.99
R4612:Gria2	UTSW	3	80732051	missense	probably damaging	1.00
R4616:Gria2	UTSW	3	80706897	missense	probably damaging	1.00
R4706:Gria2	UTSW	3	80740990	missense	probably benign
R4996:Gria2	UTSW	3	80707141	missense	probably damaging	0.99
R5502:Gria2	UTSW	3	80706945	missense	probably damaging	1.00
R5930:Gria2	UTSW	3	80707249	missense	possibly damaging	0.91
R6142:Gria2	UTSW	3	80801717	missense	probably benign	0.13
R6233:Gria2	UTSW	3	80707203	missense	probably damaging	0.99
R6317:Gria2	UTSW	3	80741004	missense	possibly damaging	0.79
R6453:Gria2	UTSW	3	80740974	missense	possibly damaging	0.93
R6526:Gria2	UTSW	3	80692469	missense	probably damaging	1.00
R6545:Gria2	UTSW	3	80741144	missense	probably damaging	0.99
R6574:Gria2	UTSW	3	80689296	missense	probably damaging	0.99
R6720:Gria2	UTSW	3	80802304	missense	probably benign	0.37
R7009:Gria2	UTSW	3	80706972	missense	probably damaging	1.00
R7049:Gria2	UTSW	3	80689327	missense	probably damaging	0.99
R7191:Gria2	UTSW	3	80732085	missense	probably benign	0.24
R7374:Gria2	UTSW	3	80741076	missense	probably benign
R7837:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R8034:Gria2	UTSW	3	80801699	missense	probably damaging	1.00
R8125:Gria2	UTSW	3	80707243	missense	possibly damaging	0.88
R8189:Gria2	UTSW	3	80722182	missense	probably damaging	1.00
R8209:Gria2	UTSW	3	80709457	missense	probably benign	0.01
R8362:Gria2	UTSW	3	80707890	missense	possibly damaging	0.82
R8516:Gria2	UTSW	3	80706987	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CCTCAGCAAATTAGATCCTCTGC -3'
(R):5'- AGGTCTCTAAGAGGCACCAG -3'

Sequencing Primer
(F):5'- CTGCATTTTGAGGTCGAAATTTAGC -3'
(R):5'- AGAAGCTGCCAGGGCTGTG -3'

Posted On

2019-06-26