Incidental Mutation 'R7225:Txk'
ID562085
Institutional Source Beutler Lab
Gene Symbol Txk
Ensembl Gene ENSMUSG00000054892
Gene NameTXK tyrosine kinase
SynonymsA130089B16Rik, PTK4, Btkl, Rlk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location72695978-72752777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72700714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 418 (D418N)
Ref Sequence ENSEMBL: ENSMUSP00000109234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113604] [ENSMUST00000169534] [ENSMUST00000197313] [ENSMUST00000198464]
Predicted Effect probably damaging
Transcript: ENSMUST00000113604
AA Change: D418N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109234
Gene: ENSMUSG00000054892
AA Change: D418N

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169534
AA Change: D418N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129397
Gene: ENSMUSG00000054892
AA Change: D418N

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197313
AA Change: D396N

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143476
Gene: ENSMUSG00000054892
AA Change: D396N

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 138 1.2e-9 SMART
SH2 126 215 3.1e-35 SMART
TyrKc 249 498 1.2e-136 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198464
AA Change: D364N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143002
Gene: ENSMUSG00000054892
AA Change: D364N

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
SH3 31 87 6.3e-19 SMART
SH2 94 183 5.4e-36 SMART
TyrKc 217 466 1.2e-136 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to parasitic (Toxoplasma gondii) infection and decreased cytokine secretion in stimulated splenocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Txk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Txk APN 5 72707546 missense possibly damaging 0.94
IGL02602:Txk APN 5 72707720 missense possibly damaging 0.89
IGL03353:Txk APN 5 72736402 missense probably benign
R0402:Txk UTSW 5 72731762 critical splice donor site probably null
R1509:Txk UTSW 5 72699110 missense probably damaging 1.00
R1511:Txk UTSW 5 72707671 missense probably damaging 1.00
R1785:Txk UTSW 5 72696579 missense probably damaging 1.00
R1786:Txk UTSW 5 72696579 missense probably damaging 1.00
R2131:Txk UTSW 5 72696579 missense probably damaging 1.00
R2913:Txk UTSW 5 72724451 missense probably damaging 1.00
R2914:Txk UTSW 5 72724451 missense probably damaging 1.00
R3722:Txk UTSW 5 72707735 nonsense probably null
R4080:Txk UTSW 5 72700663 missense probably damaging 1.00
R5341:Txk UTSW 5 72696621 missense probably benign 0.08
R5580:Txk UTSW 5 72707589 missense probably damaging 1.00
R6155:Txk UTSW 5 72700726 missense probably damaging 1.00
R6310:Txk UTSW 5 72736417 missense probably benign 0.01
R6382:Txk UTSW 5 72736480 intron probably benign
R6938:Txk UTSW 5 72699149 missense probably damaging 0.99
R7327:Txk UTSW 5 72715883 missense probably damaging 0.98
R7337:Txk UTSW 5 72731766 nonsense probably null
R7436:Txk UTSW 5 72696579 missense probably damaging 1.00
R7510:Txk UTSW 5 72736383 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGGCTATACAGAGAAACCCTG -3'
(R):5'- ACCTGGTTCTAGAGGAGAAAAC -3'

Sequencing Primer
(F):5'- GGCTATACAGAGAAACCCTGTCTTG -3'
(R):5'- GGCTGTTTTAGCAGATCC -3'
Posted On2019-06-26