Incidental Mutation 'R7225:5430403G16Rik'
ID 562087
Institutional Source Beutler Lab
Gene Symbol 5430403G16Rik
Ensembl Gene ENSMUSG00000072763
Gene Name RIKEN cDNA 5430403G16 gene
Synonyms ENSMUSG00000072763
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7225 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109674545-109691041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109677149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 145 (H145R)
Ref Sequence ENSEMBL: ENSMUSP00000090395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092720]
AlphaFold D3Z5L4
Predicted Effect possibly damaging
Transcript: ENSMUST00000092720
AA Change: H145R

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090395
Gene: ENSMUSG00000072763
AA Change: H145R

DomainStartEndE-ValueType
KRAB 4 60 2.47e-14 SMART
ZnF_C2H2 131 153 3.39e-3 SMART
ZnF_C2H2 159 181 3.95e-4 SMART
ZnF_C2H2 187 209 3.95e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 4.01e-5 SMART
ZnF_C2H2 271 293 7.78e-3 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 1.36e-2 SMART
ZnF_C2H2 355 377 7.37e-4 SMART
ZnF_C2H2 383 405 1.3e-4 SMART
ZnF_C2H2 411 433 3.69e-4 SMART
ZnF_C2H2 439 461 4.3e-5 SMART
ZnF_C2H2 467 489 2.57e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 2.05e-2 SMART
ZnF_C2H2 551 573 5.59e-4 SMART
ZnF_C2H2 579 601 1.58e-3 SMART
ZnF_C2H2 607 629 9.08e-4 SMART
ZnF_C2H2 635 657 3.44e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in 5430403G16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:5430403G16Rik APN 5 109677316 nonsense probably null
IGL02547:5430403G16Rik APN 5 109678762 critical splice donor site probably null
IGL02589:5430403G16Rik APN 5 109678520 missense possibly damaging 0.95
BB007:5430403G16Rik UTSW 5 109675756 nonsense probably null
BB017:5430403G16Rik UTSW 5 109675756 nonsense probably null
R0363:5430403G16Rik UTSW 5 109676888 missense probably benign 0.03
R0628:5430403G16Rik UTSW 5 109678576 critical splice acceptor site probably null
R2858:5430403G16Rik UTSW 5 109675953 missense probably benign 0.02
R4914:5430403G16Rik UTSW 5 109678530 missense probably damaging 1.00
R4945:5430403G16Rik UTSW 5 109677075 missense possibly damaging 0.60
R5444:5430403G16Rik UTSW 5 109675636 nonsense probably null
R6000:5430403G16Rik UTSW 5 109676864 missense probably benign 0.19
R6258:5430403G16Rik UTSW 5 109676567 missense probably benign 0.01
R6389:5430403G16Rik UTSW 5 109676019 missense possibly damaging 0.84
R6945:5430403G16Rik UTSW 5 109676845 missense probably benign 0.25
R7581:5430403G16Rik UTSW 5 109690788 start gained probably benign
R7810:5430403G16Rik UTSW 5 109677304 nonsense probably null
R7930:5430403G16Rik UTSW 5 109675756 nonsense probably null
R8821:5430403G16Rik UTSW 5 109676308 missense probably benign 0.00
R8825:5430403G16Rik UTSW 5 109678880 missense probably damaging 1.00
R8831:5430403G16Rik UTSW 5 109676308 missense probably benign 0.00
R9179:5430403G16Rik UTSW 5 109675842 missense probably damaging 1.00
R9429:5430403G16Rik UTSW 5 109676468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTGAGAGGCAAAGGCTTTG -3'
(R):5'- ACATTTGCCAATTATCTTTGCAGGC -3'

Sequencing Primer
(F):5'- TGCGTACAAAGGCTTTACCG -3'
(R):5'- GGTAAAGCCTTTGCATGTCACAG -3'
Posted On 2019-06-26