Incidental Mutation 'R7225:Actn4'
ID562091
Institutional Source Beutler Lab
Gene Symbol Actn4
Ensembl Gene ENSMUSG00000054808
Gene Nameactinin alpha 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28893248-28962340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28898699 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 492 (V492D)
Ref Sequence ENSEMBL: ENSMUSP00000066068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000217157]
Predicted Effect probably damaging
Transcript: ENSMUST00000068045
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: V492D

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127210
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808
AA Change: V492D

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216863
Predicted Effect probably damaging
Transcript: ENSMUST00000217157
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Actn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Actn4 APN 7 28904684 missense probably damaging 1.00
IGL02127:Actn4 APN 7 28897880 missense probably benign
IGL02192:Actn4 APN 7 28898400 missense possibly damaging 0.93
IGL02862:Actn4 APN 7 28912234 splice site probably benign
IGL03339:Actn4 APN 7 28901982 missense probably damaging 1.00
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0243:Actn4 UTSW 7 28905398 missense probably benign 0.29
R0689:Actn4 UTSW 7 28897049 missense probably damaging 1.00
R0845:Actn4 UTSW 7 28913430 missense probably damaging 1.00
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1469:Actn4 UTSW 7 28898266 splice site probably benign
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1581:Actn4 UTSW 7 28898646 missense probably benign 0.04
R1690:Actn4 UTSW 7 28911525 missense probably damaging 1.00
R1962:Actn4 UTSW 7 28894622 missense probably damaging 1.00
R2113:Actn4 UTSW 7 28898124 missense probably benign 0.42
R2215:Actn4 UTSW 7 28918753 missense possibly damaging 0.88
R2429:Actn4 UTSW 7 28898071 missense probably benign 0.00
R3945:Actn4 UTSW 7 28912236 splice site probably null
R3962:Actn4 UTSW 7 28898222 splice site probably null
R3970:Actn4 UTSW 7 28962032 missense probably benign
R4909:Actn4 UTSW 7 28898657 missense probably damaging 1.00
R4985:Actn4 UTSW 7 28918986 missense probably damaging 1.00
R5155:Actn4 UTSW 7 28962017 critical splice donor site probably null
R5201:Actn4 UTSW 7 28916255 splice site probably null
R5668:Actn4 UTSW 7 28904550 missense probably damaging 1.00
R5818:Actn4 UTSW 7 28919019 missense probably damaging 1.00
R6046:Actn4 UTSW 7 28904619 missense probably benign 0.03
R6155:Actn4 UTSW 7 28896141 missense probably damaging 1.00
R6559:Actn4 UTSW 7 28907036 missense possibly damaging 0.87
R7224:Actn4 UTSW 7 28962084 missense probably benign 0.08
R7423:Actn4 UTSW 7 28894255 missense probably damaging 0.97
R7665:Actn4 UTSW 7 28916207 missense probably damaging 1.00
R7704:Actn4 UTSW 7 28897042 missense possibly damaging 0.76
R8096:Actn4 UTSW 7 28894583 missense possibly damaging 0.88
R8096:Actn4 UTSW 7 28901913 missense probably damaging 1.00
Z1088:Actn4 UTSW 7 28894578 missense probably damaging 1.00
Z1177:Actn4 UTSW 7 28919049 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTGGTCGATGGTCTCTAGC -3'
(R):5'- AGGTAGCATCACTGAGGCAG -3'

Sequencing Primer
(F):5'- AGGCAGGTCAGCTGGTG -3'
(R):5'- ATCACTGAGGCAGACGCTGAC -3'
Posted On2019-06-26