Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Actn4'

562091

Institutional Source

Beutler Lab

Gene Symbol

Actn4

Ensembl Gene

ENSMUSG00000054808

Gene Name

actinin alpha 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.841) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28893248-28962340 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28898699 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 492 (V492D)

Ref Sequence

ENSEMBL: ENSMUSP00000066068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000217157]

AlphaFold

P57780

Predicted Effect

probably damaging
Transcript: ENSMUST00000068045
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: V492D

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
CH	53	153	1.08e-24	SMART
CH	166	265	3.49e-24	SMART
SPEC	297	403	2.83e0	SMART
SPEC	417	518	3.78e-23	SMART
SPEC	532	639	8.64e-9	SMART
SPEC	653	752	3.56e0	SMART
EFh	770	798	1.92e-3	SMART
EFh	811	839	1.56e-3	SMART
efhand_Ca_insen	842	908	1.27e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127210
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808
AA Change: V492D

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
CH	53	153	1.08e-24	SMART
CH	166	265	1.03e-21	SMART
SPEC	297	403	2.83e0	SMART
SPEC	417	518	3.78e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000216863

Predicted Effect

probably damaging
Transcript: ENSMUST00000217157
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Actn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Actn4	APN	7	28904684	missense	probably damaging	1.00
IGL02127:Actn4	APN	7	28897880	missense	probably benign
IGL02192:Actn4	APN	7	28898400	missense	possibly damaging	0.93
IGL02862:Actn4	APN	7	28912234	splice site	probably benign
IGL03339:Actn4	APN	7	28901982	missense	probably damaging	1.00
R0067:Actn4	UTSW	7	28911570	missense	possibly damaging	0.67
R0067:Actn4	UTSW	7	28911570	missense	possibly damaging	0.67
R0243:Actn4	UTSW	7	28905398	missense	probably benign	0.29
R0689:Actn4	UTSW	7	28897049	missense	probably damaging	1.00
R0845:Actn4	UTSW	7	28913430	missense	probably damaging	1.00
R1469:Actn4	UTSW	7	28905328	missense	probably benign	0.15
R1469:Actn4	UTSW	7	28898266	splice site	probably benign
R1469:Actn4	UTSW	7	28905328	missense	probably benign	0.15
R1581:Actn4	UTSW	7	28898646	missense	probably benign	0.04
R1690:Actn4	UTSW	7	28911525	missense	probably damaging	1.00
R1962:Actn4	UTSW	7	28894622	missense	probably damaging	1.00
R2113:Actn4	UTSW	7	28898124	missense	probably benign	0.42
R2215:Actn4	UTSW	7	28918753	missense	possibly damaging	0.88
R2429:Actn4	UTSW	7	28898071	missense	probably benign	0.00
R3945:Actn4	UTSW	7	28912236	splice site	probably null
R3962:Actn4	UTSW	7	28898222	splice site	probably null
R3970:Actn4	UTSW	7	28962032	missense	probably benign
R4909:Actn4	UTSW	7	28898657	missense	probably damaging	1.00
R4985:Actn4	UTSW	7	28918986	missense	probably damaging	1.00
R5155:Actn4	UTSW	7	28962017	critical splice donor site	probably null
R5201:Actn4	UTSW	7	28916255	splice site	probably null
R5668:Actn4	UTSW	7	28904550	missense	probably damaging	1.00
R5818:Actn4	UTSW	7	28919019	missense	probably damaging	1.00
R6046:Actn4	UTSW	7	28904619	missense	probably benign	0.03
R6155:Actn4	UTSW	7	28896141	missense	probably damaging	1.00
R6559:Actn4	UTSW	7	28907036	missense	possibly damaging	0.87
R7224:Actn4	UTSW	7	28962084	missense	probably benign	0.08
R7423:Actn4	UTSW	7	28894255	missense	probably damaging	0.97
R7665:Actn4	UTSW	7	28916207	missense	probably damaging	1.00
R7704:Actn4	UTSW	7	28897042	missense	possibly damaging	0.76
R8096:Actn4	UTSW	7	28894583	missense	possibly damaging	0.88
R8096:Actn4	UTSW	7	28901913	missense	probably damaging	1.00
R8954:Actn4	UTSW	7	28895158	missense	probably damaging	0.96
R8987:Actn4	UTSW	7	28896973	missense	probably benign	0.00
R9128:Actn4	UTSW	7	28894504	missense	possibly damaging	0.90
Z1088:Actn4	UTSW	7	28894578	missense	probably damaging	1.00
Z1177:Actn4	UTSW	7	28919049	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCTGGTCGATGGTCTCTAGC -3'
(R):5'- AGGTAGCATCACTGAGGCAG -3'

Sequencing Primer
(F):5'- AGGCAGGTCAGCTGGTG -3'
(R):5'- ATCACTGAGGCAGACGCTGAC -3'

Posted On

2019-06-26