Incidental Mutation 'R7225:Tshz3'
ID 562094
Institutional Source Beutler Lab
Gene Symbol Tshz3
Ensembl Gene ENSMUSG00000021217
Gene Name teashirt zinc finger family member 3
Synonyms Tsh3, teashirt3, A630038G13Rik, Zfp537
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7225 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 36698118-36773553 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36769657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 357 (N357S)
Ref Sequence ENSEMBL: ENSMUSP00000021641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021641
AA Change: N357S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217
AA Change: N357S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
low complexity region 142 164 N/A INTRINSIC
ZnF_C2H2 214 238 1.86e0 SMART
ZnF_C2H2 275 299 3.83e-2 SMART
low complexity region 313 334 N/A INTRINSIC
ZnF_C2H2 386 410 5.62e0 SMART
low complexity region 483 497 N/A INTRINSIC
coiled coil region 609 630 N/A INTRINSIC
low complexity region 796 832 N/A INTRINSIC
low complexity region 855 872 N/A INTRINSIC
HOX 890 964 2.55e-4 SMART
ZnF_C2H2 976 998 8.09e0 SMART
ZnF_C2H2 1041 1064 2.4e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Tshz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Tshz3 APN 7 36769960 missense probably damaging 0.97
IGL01922:Tshz3 APN 7 36769605 missense probably damaging 1.00
IGL02047:Tshz3 APN 7 36770468 missense probably damaging 1.00
IGL02166:Tshz3 APN 7 36768921 missense probably benign 0.00
IGL02405:Tshz3 APN 7 36769650 missense possibly damaging 0.93
IGL02658:Tshz3 APN 7 36769158 missense probably damaging 0.99
IGL02968:Tshz3 APN 7 36769824 missense probably damaging 1.00
IGL03073:Tshz3 APN 7 36770745 missense probably damaging 1.00
IGL03233:Tshz3 APN 7 36770079 missense probably damaging 0.97
IGL03296:Tshz3 APN 7 36771336 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0090:Tshz3 UTSW 7 36768892 missense probably benign
R0329:Tshz3 UTSW 7 36770033 missense probably benign
R0330:Tshz3 UTSW 7 36770033 missense probably benign
R0360:Tshz3 UTSW 7 36770533 missense probably benign
R0364:Tshz3 UTSW 7 36770533 missense probably benign
R0380:Tshz3 UTSW 7 36771300 missense probably damaging 1.00
R0547:Tshz3 UTSW 7 36771417 missense probably damaging 1.00
R1061:Tshz3 UTSW 7 36768706 missense probably damaging 1.00
R1618:Tshz3 UTSW 7 36771796 missense probably damaging 1.00
R1704:Tshz3 UTSW 7 36771360 missense possibly damaging 0.92
R1881:Tshz3 UTSW 7 36771654 missense possibly damaging 0.87
R1926:Tshz3 UTSW 7 36769375 missense probably damaging 1.00
R1994:Tshz3 UTSW 7 36769822 missense probably damaging 0.99
R2404:Tshz3 UTSW 7 36770380 missense probably damaging 0.99
R2447:Tshz3 UTSW 7 36768753 missense probably benign 0.00
R2930:Tshz3 UTSW 7 36771592 missense possibly damaging 0.74
R3879:Tshz3 UTSW 7 36771537 nonsense probably null
R4033:Tshz3 UTSW 7 36770584 missense possibly damaging 0.71
R4212:Tshz3 UTSW 7 36770119 missense probably damaging 1.00
R4394:Tshz3 UTSW 7 36769605 missense probably damaging 1.00
R4779:Tshz3 UTSW 7 36768972 missense probably damaging 1.00
R4977:Tshz3 UTSW 7 36771190 missense probably benign 0.31
R5139:Tshz3 UTSW 7 36771025 missense probably benign 0.23
R5448:Tshz3 UTSW 7 36771229 missense possibly damaging 0.90
R5516:Tshz3 UTSW 7 36770350 missense probably benign 0.03
R5760:Tshz3 UTSW 7 36771569 missense probably damaging 1.00
R6360:Tshz3 UTSW 7 36769441 missense probably damaging 1.00
R6481:Tshz3 UTSW 7 36752339 splice site probably null
R6535:Tshz3 UTSW 7 36768789 missense probably damaging 1.00
R7105:Tshz3 UTSW 7 36769756 missense probably damaging 1.00
R7133:Tshz3 UTSW 7 36770569 missense probably benign 0.12
R7238:Tshz3 UTSW 7 36770097 missense probably damaging 1.00
R7851:Tshz3 UTSW 7 36771589 missense probably damaging 1.00
R7938:Tshz3 UTSW 7 36769158 missense probably damaging 0.99
R8344:Tshz3 UTSW 7 36771537 missense probably damaging 0.98
X0067:Tshz3 UTSW 7 36768796 missense probably benign 0.19
X0067:Tshz3 UTSW 7 36769321 missense probably damaging 1.00
Z1186:Tshz3 UTSW 7 36768916 missense probably benign
Z1186:Tshz3 UTSW 7 36770574 missense probably benign
Z1191:Tshz3 UTSW 7 36768916 missense probably benign
Z1191:Tshz3 UTSW 7 36770574 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTGGCCACTCCTTTGAG -3'
(R):5'- CTTGATAAAGTGGCCAGTGACC -3'

Sequencing Primer
(F):5'- GACCTGAGCGTCCATATGATC -3'
(R):5'- ACCATCATGTGAGCTGTGAGC -3'
Posted On 2019-06-26