Incidental Mutation 'R7225:Rpsa'
ID562102
Institutional Source Beutler Lab
Gene Symbol Rpsa
Ensembl Gene ENSMUSG00000032518
Gene Nameribosomal protein SA
SynonymsLamr, P40-8, 67lr, Lamrl1, Lamr1, P40-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120127689-120132369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120131156 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 262 (F262V)
Ref Sequence ENSEMBL: ENSMUSP00000035105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]
Predicted Effect probably benign
Transcript: ENSMUST00000035105
AA Change: F262V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: F262V

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 18 118 3.7e-12 PFAM
Pfam:Ribosomal_S2 111 184 6.5e-14 PFAM
Pfam:40S_SA_C 202 295 2.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217317
AA Change: F262V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217352
Predicted Effect probably benign
Transcript: ENSMUST00000217356
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Rpsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02503:Rpsa APN 9 120128593 missense possibly damaging 0.57
IGL02522:Rpsa APN 9 120131055 missense possibly damaging 0.47
PIT4515001:Rpsa UTSW 9 120131148 missense probably benign 0.04
R0281:Rpsa UTSW 9 120131003 missense possibly damaging 0.81
R1511:Rpsa UTSW 9 120131000 missense possibly damaging 0.64
R4942:Rpsa UTSW 9 120131063 missense probably benign 0.04
R5814:Rpsa UTSW 9 120128485 start gained probably benign
R6122:Rpsa UTSW 9 120131036 missense probably benign 0.01
R6545:Rpsa UTSW 9 120130257 missense probably benign 0.11
RF012:Rpsa UTSW 9 120131039 missense probably benign 0.01
Z1176:Rpsa UTSW 9 120130346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACCTTGGTTCTGGTTC -3'
(R):5'- ATTACCCCAAGAGCAGTGTCAAG -3'

Sequencing Primer
(F):5'- GTTCAGTGAAGCTAATTTTGTCCC -3'
(R):5'- TGTCAAGACACAGTGTATCCAC -3'
Posted On2019-06-26