Mutagenetix > Incidental Mutation

Incidental Mutation 'R7225:Rpsa'

562102

Institutional Source

Beutler Lab

Gene Symbol

Rpsa

Ensembl Gene

ENSMUSG00000032518

Gene Name

ribosomal protein SA

Synonyms

Lamr, P40-8, 67lr, Lamrl1, Lamr1, P40-3

MMRRC Submission

045297-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120127689-120132369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 120131156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 262 (F262V)

Ref Sequence

ENSEMBL: ENSMUSP00000035105 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]

AlphaFold

P14206

Predicted Effect

probably benign
Transcript: ENSMUST00000035105
AA Change: F262V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: F262V

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S2	18	118	3.7e-12	PFAM
Pfam:Ribosomal_S2	111	184	6.5e-14	PFAM
Pfam:40S_SA_C	202	295	2.9e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217317
AA Change: F262V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000217352

Predicted Effect

probably benign
Transcript: ENSMUST00000217356

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Rpsa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02503:Rpsa	APN	9	120128593	missense	possibly damaging	0.57
IGL02522:Rpsa	APN	9	120131055	missense	possibly damaging	0.47
PIT4515001:Rpsa	UTSW	9	120131148	missense	probably benign	0.04
R0281:Rpsa	UTSW	9	120131003	missense	possibly damaging	0.81
R1511:Rpsa	UTSW	9	120131000	missense	possibly damaging	0.64
R4942:Rpsa	UTSW	9	120131063	missense	probably benign	0.04
R5814:Rpsa	UTSW	9	120128485	start gained	probably benign
R6122:Rpsa	UTSW	9	120131036	missense	probably benign	0.01
R6545:Rpsa	UTSW	9	120130257	missense	probably benign	0.11
R8554:Rpsa	UTSW	9	120129251	missense	possibly damaging	0.80
RF012:Rpsa	UTSW	9	120131039	missense	probably benign	0.01
Z1176:Rpsa	UTSW	9	120130346	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGACCTTGGTTCTGGTTC -3'
(R):5'- ATTACCCCAAGAGCAGTGTCAAG -3'

Sequencing Primer
(F):5'- GTTCAGTGAAGCTAATTTTGTCCC -3'
(R):5'- TGTCAAGACACAGTGTATCCAC -3'

Posted On

2019-06-26