Incidental Mutation 'R7225:Cnp'
ID562109
Institutional Source Beutler Lab
Gene Symbol Cnp
Ensembl Gene ENSMUSG00000006782
Gene Name2',3'-cyclic nucleotide 3' phosphodiesterase
SynonymsCNPase, Cnp-1, Cnp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100574904-100591729 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 100580587 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 352 (Q352*)
Ref Sequence ENSEMBL: ENSMUSP00000099409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000103120]
PDB Structure
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with sulfate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic NADP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with GTP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic AMP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3-(SP)-Cyclic-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3'- cyclic AMP [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000014339
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103120
AA Change: Q352*
SMART Domains Protein: ENSMUSP00000099409
Gene: ENSMUSG00000006782
AA Change: Q352*

DomainStartEndE-ValueType
Pfam:AAA_33 52 175 8.9e-10 PFAM
Pfam:CNPase 185 419 7.1e-118 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in ataxia, gait abnormalities, hindlimb paralysis, muscle weakness, convulsive seizures, weight loss, kyphosis, reactive gliosis, axonal swellings and degeneration, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Cnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Cnp APN 11 100576699 missense probably benign 0.25
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0015:Cnp UTSW 11 100578908 splice site probably null
R0015:Cnp UTSW 11 100578908 splice site probably null
R0546:Cnp UTSW 11 100580723 missense probably damaging 1.00
R2384:Cnp UTSW 11 100576453 missense probably damaging 1.00
R4653:Cnp UTSW 11 100576516 missense probably benign 0.19
R4654:Cnp UTSW 11 100579051 missense possibly damaging 0.90
R4898:Cnp UTSW 11 100576376 missense probably benign 0.11
R5559:Cnp UTSW 11 100576417 missense probably damaging 1.00
R7045:Cnp UTSW 11 100580358 missense probably benign 0.00
R7776:Cnp UTSW 11 100578988 missense probably damaging 1.00
R8350:Cnp UTSW 11 100576441 missense probably damaging 1.00
R8450:Cnp UTSW 11 100576441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGTGACACCCAAGACAGC -3'
(R):5'- TCAGATGATGGTGCAGATCTG -3'

Sequencing Primer
(F):5'- CAAGACAGCTGGGGCCC -3'
(R):5'- AGATCTGCATGGCACCCC -3'
Posted On2019-06-26