Incidental Mutation 'R7225:1700001K19Rik'
ID 562112
Institutional Source Beutler Lab
Gene Symbol 1700001K19Rik
Ensembl Gene ENSMUSG00000056508
Gene Name RIKEN cDNA 1700001K19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R7225 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 110667688-110682619 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 110670865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851] [ENSMUST00000070659] [ENSMUST00000222915]
AlphaFold Q80ZT1
Predicted Effect probably benign
Transcript: ENSMUST00000018851
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070659
SMART Domains Protein: ENSMUSP00000068238
Gene: ENSMUSG00000056508

DomainStartEndE-ValueType
low complexity region 196 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222915
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in 1700001K19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:1700001K19Rik UTSW 12 110668449 unclassified probably benign
FR4304:1700001K19Rik UTSW 12 110668450 unclassified probably benign
FR4548:1700001K19Rik UTSW 12 110668449 unclassified probably benign
FR4548:1700001K19Rik UTSW 12 110668452 unclassified probably benign
FR4737:1700001K19Rik UTSW 12 110668448 unclassified probably benign
FR4976:1700001K19Rik UTSW 12 110668447 unclassified probably benign
FR4976:1700001K19Rik UTSW 12 110668450 unclassified probably benign
R0266:1700001K19Rik UTSW 12 110668754 missense possibly damaging 0.59
R1345:1700001K19Rik UTSW 12 110668718 missense probably damaging 1.00
R1859:1700001K19Rik UTSW 12 110670834 start gained probably benign
R7020:1700001K19Rik UTSW 12 110668541 missense probably damaging 1.00
R7311:1700001K19Rik UTSW 12 110668750 missense probably benign
R8410:1700001K19Rik UTSW 12 110668711 missense probably benign 0.21
R9001:1700001K19Rik UTSW 12 110670742 missense probably damaging 1.00
RF022:1700001K19Rik UTSW 12 110668443 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATACAAAGATGGGTGTCTCC -3'
(R):5'- GAGTTATAGCCACAGCCCTTAC -3'

Sequencing Primer
(F):5'- TGTCTCCCACACATACACCAC -3'
(R):5'- ACATAGGGTCTTGCTATGTCCCAAG -3'
Posted On 2019-06-26