Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Gpc5'

562115

Institutional Source

Beutler Lab

Gene Symbol

Gpc5

Ensembl Gene

ENSMUSG00000022112

Gene Name

glypican 5

Synonyms

A230034F01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115092215-116525179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 115552298 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 528 (V528G)

Ref Sequence

ENSEMBL: ENSMUSP00000135085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000176912]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022707
AA Change: V455G

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: V455G

Domain	Start	End	E-Value	Type
Pfam:Glypican	9	572	1.8e-182	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176912
AA Change: V528G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: V528G

Domain	Start	End	E-Value	Type
Pfam:Glypican	85	642	1.6e-174	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Gpc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Gpc5	APN	14	115370024	missense	probably damaging	1.00
IGL01298:Gpc5	APN	14	115399188	missense	probably benign	0.14
IGL01359:Gpc5	APN	14	115369750	missense	possibly damaging	0.74
IGL02354:Gpc5	APN	14	115133287	nonsense	probably null
IGL02361:Gpc5	APN	14	115133287	nonsense	probably null
IGL02982:Gpc5	APN	14	115369988	missense	probably damaging	1.00
IGL03120:Gpc5	APN	14	115370144	missense	possibly damaging	0.64
R0322:Gpc5	UTSW	14	115399151	missense	probably benign	0.05
R0396:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R0555:Gpc5	UTSW	14	115552328	missense	probably damaging	0.98
R0629:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R1536:Gpc5	UTSW	14	115399250	missense	probably benign	0.09
R1660:Gpc5	UTSW	14	115399279	missense	probably benign	0.12
R1676:Gpc5	UTSW	14	115370098	missense	probably damaging	1.00
R2328:Gpc5	UTSW	14	115788179	missense	probably damaging	0.99
R3522:Gpc5	UTSW	14	116524335	missense	probably benign	0.00
R3776:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3885:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3889:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3893:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R4041:Gpc5	UTSW	14	115133216	missense	probably damaging	1.00
R4517:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R5068:Gpc5	UTSW	14	115417264	makesense	probably null
R5639:Gpc5	UTSW	14	115092747	missense	probably benign	0.13
R5730:Gpc5	UTSW	14	115788314	missense	possibly damaging	0.73
R5944:Gpc5	UTSW	14	115369838	missense	probably benign	0.24
R6351:Gpc5	UTSW	14	115399200	missense	probably benign	0.01
R6557:Gpc5	UTSW	14	115092534	unclassified	probably benign
R6657:Gpc5	UTSW	14	115370198	missense	probably benign	0.01
R6714:Gpc5	UTSW	14	115552303	nonsense	probably null
R6751:Gpc5	UTSW	14	115369951	missense	probably benign	0.00
R7057:Gpc5	UTSW	14	115133242	missense	possibly damaging	0.64
R7142:Gpc5	UTSW	14	115417203	missense	probably benign	0.01
R7544:Gpc5	UTSW	14	115428173	missense	probably damaging	1.00
R7658:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R7695:Gpc5	UTSW	14	115092594	missense	unknown
R7785:Gpc5	UTSW	14	115417220	missense	probably benign	0.00
R8116:Gpc5	UTSW	14	115399225	missense	probably damaging	0.98
R8303:Gpc5	UTSW	14	115428255	missense	probably benign	0.01
RF001:Gpc5	UTSW	14	115417178	missense	probably benign	0.41
RF022:Gpc5	UTSW	14	115552276	missense	probably damaging	1.00
Z1176:Gpc5	UTSW	14	115369964	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTCTGAAGCCAGGTGTCTC -3'
(R):5'- GTCACAGATGCACACTCTCC -3'

Sequencing Primer
(F):5'- TCGGGGACTCTGAAGATGCTC -3'
(R):5'- TCTCCACCCATATCATTAGAACTGAG -3'

Posted On

2019-06-26