Incidental Mutation 'R7225:Pcdhb13'
ID562124
Institutional Source Beutler Lab
Gene Symbol Pcdhb13
Ensembl Gene ENSMUSG00000047307
Gene Nameprotocadherin beta 13
SynonymsPcdhbM, Pcdbh6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37442500-37446209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37444437 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 623 (R623C)
Ref Sequence ENSEMBL: ENSMUSP00000061087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000052387
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056915
AA Change: R623C

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307
AA Change: R623C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.3516 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. Unlike the alpha and gamma clusters, the transcripts from these genes do not share common 3' exons. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell neural connections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Pcdhb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Pcdhb13 APN 18 37443721 missense possibly damaging 0.56
IGL00718:Pcdhb13 APN 18 37444821 missense possibly damaging 0.91
IGL01143:Pcdhb13 APN 18 37442637 missense probably benign 0.01
IGL01816:Pcdhb13 APN 18 37442975 missense probably benign 0.00
IGL01916:Pcdhb13 APN 18 37443861 missense possibly damaging 0.64
IGL02063:Pcdhb13 APN 18 37444229 missense probably damaging 1.00
IGL02153:Pcdhb13 APN 18 37443685 missense probably damaging 1.00
IGL02332:Pcdhb13 APN 18 37443582 missense probably benign 0.32
IGL02407:Pcdhb13 APN 18 37443075 missense probably damaging 1.00
IGL02423:Pcdhb13 APN 18 37444339 missense possibly damaging 0.95
IGL02514:Pcdhb13 APN 18 37442991 missense possibly damaging 0.80
IGL03025:Pcdhb13 APN 18 37442764 missense probably damaging 1.00
IGL03227:Pcdhb13 APN 18 37443658 missense probably damaging 0.98
IGL03233:Pcdhb13 APN 18 37444265 missense probably damaging 0.96
IGL03239:Pcdhb13 APN 18 37442835 missense probably damaging 0.97
R0046:Pcdhb13 UTSW 18 37444257 missense probably benign
R0172:Pcdhb13 UTSW 18 37442937 missense probably benign 0.00
R0201:Pcdhb13 UTSW 18 37442581 missense probably benign
R0594:Pcdhb13 UTSW 18 37443931 missense probably damaging 1.00
R1235:Pcdhb13 UTSW 18 37444959 makesense probably null
R1292:Pcdhb13 UTSW 18 37443832 missense probably benign 0.43
R1481:Pcdhb13 UTSW 18 37442836 missense probably damaging 1.00
R1991:Pcdhb13 UTSW 18 37443859 missense possibly damaging 0.80
R2058:Pcdhb13 UTSW 18 37444567 missense possibly damaging 0.95
R3508:Pcdhb13 UTSW 18 37443151 missense probably damaging 0.99
R3713:Pcdhb13 UTSW 18 37443733 missense probably damaging 1.00
R4125:Pcdhb13 UTSW 18 37443820 missense probably damaging 1.00
R4741:Pcdhb13 UTSW 18 37443518 missense probably benign 0.01
R4747:Pcdhb13 UTSW 18 37444815 missense probably damaging 0.99
R4957:Pcdhb13 UTSW 18 37444784 missense possibly damaging 0.95
R4973:Pcdhb13 UTSW 18 37443184 missense probably benign 0.20
R5354:Pcdhb13 UTSW 18 37444791 missense probably damaging 1.00
R5364:Pcdhb13 UTSW 18 37443508 missense probably damaging 1.00
R5544:Pcdhb13 UTSW 18 37443520 missense possibly damaging 0.92
R5897:Pcdhb13 UTSW 18 37443211 missense probably benign 0.42
R6174:Pcdhb13 UTSW 18 37443421 missense possibly damaging 0.84
R6702:Pcdhb13 UTSW 18 37444775 missense probably benign 0.42
R6765:Pcdhb13 UTSW 18 37443610 missense probably damaging 1.00
R6960:Pcdhb13 UTSW 18 37443456 missense probably benign 0.45
R7144:Pcdhb13 UTSW 18 37443256 missense probably damaging 1.00
R7239:Pcdhb13 UTSW 18 37444644 missense probably damaging 0.99
R7437:Pcdhb13 UTSW 18 37444675 missense probably damaging 1.00
R7812:Pcdhb13 UTSW 18 37442592 missense probably benign 0.00
X0023:Pcdhb13 UTSW 18 37443013 missense probably damaging 1.00
X0028:Pcdhb13 UTSW 18 37444642 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AATGACAATGCGCCCTTCG -3'
(R):5'- GTGAGCGCATCTTCAGCATC -3'

Sequencing Primer
(F):5'- TGCTCTACCCGATGCAGAATG -3'
(R):5'- TCCTCTGTGGAGTCCTGCG -3'
Posted On2019-06-26