Incidental Mutation 'R7225:Pcdhb13'
ID 562124
Institutional Source Beutler Lab
Gene Symbol Pcdhb13
Ensembl Gene ENSMUSG00000047307
Gene Name protocadherin beta 13
Synonyms PcdhbM, Pcdbh6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7225 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37442500-37446209 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37444437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 623 (R623C)
Ref Sequence ENSEMBL: ENSMUSP00000061087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91Y06
Predicted Effect probably benign
Transcript: ENSMUST00000052387
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056915
AA Change: R623C

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307
AA Change: R623C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.3516 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. Unlike the alpha and gamma clusters, the transcripts from these genes do not share common 3' exons. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell neural connections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Pcdhb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Pcdhb13 APN 18 37443721 missense possibly damaging 0.56
IGL00718:Pcdhb13 APN 18 37444821 missense possibly damaging 0.91
IGL01143:Pcdhb13 APN 18 37442637 missense probably benign 0.01
IGL01816:Pcdhb13 APN 18 37442975 missense probably benign 0.00
IGL01916:Pcdhb13 APN 18 37443861 missense possibly damaging 0.64
IGL02063:Pcdhb13 APN 18 37444229 missense probably damaging 1.00
IGL02153:Pcdhb13 APN 18 37443685 missense probably damaging 1.00
IGL02332:Pcdhb13 APN 18 37443582 missense probably benign 0.32
IGL02407:Pcdhb13 APN 18 37443075 missense probably damaging 1.00
IGL02423:Pcdhb13 APN 18 37444339 missense possibly damaging 0.95
IGL02514:Pcdhb13 APN 18 37442991 missense possibly damaging 0.80
IGL03025:Pcdhb13 APN 18 37442764 missense probably damaging 1.00
IGL03227:Pcdhb13 APN 18 37443658 missense probably damaging 0.98
IGL03233:Pcdhb13 APN 18 37444265 missense probably damaging 0.96
IGL03239:Pcdhb13 APN 18 37442835 missense probably damaging 0.97
R0046:Pcdhb13 UTSW 18 37444257 missense probably benign
R0172:Pcdhb13 UTSW 18 37442937 missense probably benign 0.00
R0201:Pcdhb13 UTSW 18 37442581 missense probably benign
R0594:Pcdhb13 UTSW 18 37443931 missense probably damaging 1.00
R1235:Pcdhb13 UTSW 18 37444959 makesense probably null
R1292:Pcdhb13 UTSW 18 37443832 missense probably benign 0.43
R1481:Pcdhb13 UTSW 18 37442836 missense probably damaging 1.00
R1991:Pcdhb13 UTSW 18 37443859 missense possibly damaging 0.80
R2058:Pcdhb13 UTSW 18 37444567 missense possibly damaging 0.95
R3508:Pcdhb13 UTSW 18 37443151 missense probably damaging 0.99
R3713:Pcdhb13 UTSW 18 37443733 missense probably damaging 1.00
R4125:Pcdhb13 UTSW 18 37443820 missense probably damaging 1.00
R4741:Pcdhb13 UTSW 18 37443518 missense probably benign 0.01
R4747:Pcdhb13 UTSW 18 37444815 missense probably damaging 0.99
R4957:Pcdhb13 UTSW 18 37444784 missense possibly damaging 0.95
R4973:Pcdhb13 UTSW 18 37443184 missense probably benign 0.20
R5354:Pcdhb13 UTSW 18 37444791 missense probably damaging 1.00
R5364:Pcdhb13 UTSW 18 37443508 missense probably damaging 1.00
R5544:Pcdhb13 UTSW 18 37443520 missense possibly damaging 0.92
R5897:Pcdhb13 UTSW 18 37443211 missense probably benign 0.42
R6174:Pcdhb13 UTSW 18 37443421 missense possibly damaging 0.84
R6702:Pcdhb13 UTSW 18 37444775 missense probably benign 0.42
R6765:Pcdhb13 UTSW 18 37443610 missense probably damaging 1.00
R6960:Pcdhb13 UTSW 18 37443456 missense probably benign 0.45
R7144:Pcdhb13 UTSW 18 37443256 missense probably damaging 1.00
R7239:Pcdhb13 UTSW 18 37444644 missense probably damaging 0.99
R7437:Pcdhb13 UTSW 18 37444675 missense probably damaging 1.00
R7812:Pcdhb13 UTSW 18 37442592 missense probably benign 0.00
R7964:Pcdhb13 UTSW 18 37444818 missense possibly damaging 0.62
R8334:Pcdhb13 UTSW 18 37444800 missense probably damaging 1.00
R8463:Pcdhb13 UTSW 18 37443234 missense possibly damaging 0.94
R8476:Pcdhb13 UTSW 18 37444084 missense probably damaging 1.00
R8501:Pcdhb13 UTSW 18 37444440 missense probably damaging 1.00
R9248:Pcdhb13 UTSW 18 37444555 missense probably damaging 1.00
X0023:Pcdhb13 UTSW 18 37443013 missense probably damaging 1.00
X0028:Pcdhb13 UTSW 18 37444642 missense possibly damaging 0.91
Z1176:Pcdhb13 UTSW 18 37443235 nonsense probably null
Z1177:Pcdhb13 UTSW 18 37442580 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGACAATGCGCCCTTCG -3'
(R):5'- GTGAGCGCATCTTCAGCATC -3'

Sequencing Primer
(F):5'- TGCTCTACCCGATGCAGAATG -3'
(R):5'- TCCTCTGTGGAGTCCTGCG -3'
Posted On 2019-06-26