Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Tcof1'

562125

Institutional Source

Beutler Lab

Gene Symbol

Tcof1

Ensembl Gene

ENSMUSG00000024613

Gene Name

treacle ribosome biogenesis factor 1

Synonyms

treacle

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60813755-60848971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60828448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 812 (T812A)

Ref Sequence

ENSEMBL: ENSMUSP00000135639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]

AlphaFold

O08784

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163446
AA Change: T812A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: T812A

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	322	2.2e-8	PFAM
Pfam:Treacle	321	793	4.6e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	855	874	N/A	INTRINSIC
low complexity region	879	893	N/A	INTRINSIC
low complexity region	916	927	N/A	INTRINSIC
low complexity region	967	977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175934
AA Change: T812A

SMART Domains

Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: T812A

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	153	329	1.6e-12	PFAM
Pfam:Treacle	321	792	6.1e-175	PFAM
Pfam:Treacle	782	936	3.2e-16	PFAM
low complexity region	969	982	N/A	INTRINSIC
low complexity region	1025	1039	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1149	1172	N/A	INTRINSIC
low complexity region	1260	1285	N/A	INTRINSIC
coiled coil region	1306	1335	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000176630
AA Change: T812A

SMART Domains

Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: T812A

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	323	2.5e-8	PFAM
Pfam:Treacle	321	793	5.9e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	843	857	N/A	INTRINSIC
low complexity region	880	891	N/A	INTRINSIC
low complexity region	933	946	N/A	INTRINSIC
low complexity region	989	1003	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1113	1136	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
coiled coil region	1270	1299	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177172
AA Change: T764A

SMART Domains

Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: T764A

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	150	322	1.3e-10	PFAM
Pfam:Treacle	321	506	1.5e-78	PFAM
Pfam:Treacle	498	745	2e-105	PFAM
low complexity region	771	786	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC
low complexity region	941	955	N/A	INTRINSIC
low complexity region	976	990	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Tcof1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tcof1	APN	18	60814568	unclassified	probably benign
IGL01339:Tcof1	APN	18	60818095	utr 3 prime	probably benign
IGL02072:Tcof1	APN	18	60831565	missense	possibly damaging	0.85
IGL02160:Tcof1	APN	18	60848743	unclassified	probably benign
IGL02513:Tcof1	APN	18	60831778	missense	possibly damaging	0.51
IGL02823:Tcof1	APN	18	60816048	missense	probably benign	0.00
IGL03161:Tcof1	APN	18	60833488	missense	possibly damaging	0.86
IGL03291:Tcof1	APN	18	60829061	missense	possibly damaging	0.71
FR4304:Tcof1	UTSW	18	60835742	unclassified	probably benign
FR4589:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
FR4737:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
PIT4802001:Tcof1	UTSW	18	60831938	missense	unknown
R0569:Tcof1	UTSW	18	60829035	missense	possibly damaging	0.85
R0602:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R0744:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0782:Tcof1	UTSW	18	60816280	missense	probably damaging	0.97
R0833:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0836:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0885:Tcof1	UTSW	18	60835850	missense	possibly damaging	0.84
R1465:Tcof1	UTSW	18	60818954	splice site	probably benign
R1528:Tcof1	UTSW	18	60814999	nonsense	probably null
R1643:Tcof1	UTSW	18	60816228	missense	possibly damaging	0.72
R1919:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R1920:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R1921:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R2023:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R2108:Tcof1	UTSW	18	60835773	missense	probably damaging	0.97
R2114:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2115:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2116:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2117:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2156:Tcof1	UTSW	18	60831829	missense	possibly damaging	0.92
R2221:Tcof1	UTSW	18	60837901	missense	possibly damaging	0.51
R2229:Tcof1	UTSW	18	60832177	intron	probably benign
R2913:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R2914:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R3944:Tcof1	UTSW	18	60822837	missense	probably damaging	0.98
R3979:Tcof1	UTSW	18	60831533	missense	possibly damaging	0.71
R4049:Tcof1	UTSW	18	60832903	missense	possibly damaging	0.84
R4125:Tcof1	UTSW	18	60819601	missense	unknown
R5047:Tcof1	UTSW	18	60831914	missense	possibly damaging	0.86
R5433:Tcof1	UTSW	18	60818033	utr 3 prime	probably benign
R5546:Tcof1	UTSW	18	60831556	missense	possibly damaging	0.85
R5832:Tcof1	UTSW	18	60819539	missense	unknown
R5965:Tcof1	UTSW	18	60833418	critical splice donor site	probably null
R6301:Tcof1	UTSW	18	60828825	missense	probably damaging	0.97
R6480:Tcof1	UTSW	18	60814780	splice site	probably null
R6910:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R6911:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7105:Tcof1	UTSW	18	60843296	missense	probably damaging	1.00
R7356:Tcof1	UTSW	18	60818094	missense	unknown
R7467:Tcof1	UTSW	18	60831905	missense	unknown
R7536:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7804:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7818:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7863:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8006:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8007:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8008:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8063:Tcof1	UTSW	18	60838762	missense	probably damaging	1.00
R8192:Tcof1	UTSW	18	60843303	missense	probably damaging	1.00
R8200:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8203:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8204:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8207:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8217:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8300:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8517:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8518:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8553:Tcof1	UTSW	18	60831571	missense	possibly damaging	0.92
R8729:Tcof1	UTSW	18	60829073	missense	unknown
R8732:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8749:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
RF001:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF007:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF009:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF010:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF011:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF013:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF015:Tcof1	UTSW	18	60833584	small insertion	probably benign
RF016:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF022:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF024:Tcof1	UTSW	18	60835738	unclassified	probably benign
RF027:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF030:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF030:Tcof1	UTSW	18	60833574	small insertion	probably benign
RF030:Tcof1	UTSW	18	60835723	unclassified	probably benign
RF031:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF031:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF035:Tcof1	UTSW	18	60833553	small insertion	probably benign
RF036:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF036:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF038:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF040:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF040:Tcof1	UTSW	18	60833583	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833576	small insertion	probably benign
RF043:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF050:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF051:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF053:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF056:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833564	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF060:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF060:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF063:Tcof1	UTSW	18	60833573	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833574	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCATCCAGGGGCATGGTG -3'
(R):5'- AGCACCATGTGTTTTGGCC -3'

Sequencing Primer
(F):5'- CCTGGAGTTAGGACTTCTATCTG -3'
(R):5'- CCATGTGTTTTGGCCCAGGC -3'

Posted On

2019-06-26