Incidental Mutation 'R7225:Tcof1'
ID562125
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60828448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 812 (T812A)
Ref Sequence ENSEMBL: ENSMUSP00000135639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163446
AA Change: T812A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: T812A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175934
AA Change: T812A
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: T812A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176630
AA Change: T812A
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: T812A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177172
AA Change: T764A
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: T764A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTTCATCCAGGGGCATGGTG -3'
(R):5'- AGCACCATGTGTTTTGGCC -3'

Sequencing Primer
(F):5'- CCTGGAGTTAGGACTTCTATCTG -3'
(R):5'- CCATGTGTTTTGGCCCAGGC -3'
Posted On2019-06-26