Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Epg5'

562127

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78012702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1697 (V1697E)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably benign
Transcript: ENSMUST00000044622
AA Change: V1697E

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V1697E

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCATTTTAGCCTTTGAGCCAC -3'
(R):5'- AGATCACGTCGCTGTTGTC -3'

Sequencing Primer
(F):5'- GTAGACCAGGCTGTTCTAAAACTC -3'
(R):5'- TTGTCCTCGCGCAGACAAG -3'

Posted On

2019-06-26