Mutagenetix > Incidental Mutation

Incidental Mutation 'R7226:Atrn'

562139

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7226 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 130986744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 1070 (C1070G)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: C1070G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: C1070G

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025B11Rik	C	T	15: 77,558,989	V17I	unknown	Het
Acad8	T	A	9: 26,978,430	K323*	probably null	Het
Adam18	A	T	8: 24,647,808	C339S	probably damaging	Het
Anxa7	A	G	14: 20,460,195	F396L	probably damaging	Het
Ap2m1	T	A	16: 20,539,451	V73D	probably damaging	Het
Asic2	A	T	11: 80,971,514	I270N	probably damaging	Het
Bag6	A	G	17: 35,142,945	N517S	unknown	Het
Cavin1	A	C	11: 100,970,458	D3E	probably benign	Het
Cc2d2b	T	C	19: 40,791,307	L571P	unknown	Het
Ccbe1	A	T	18: 66,083,128	C175S	probably damaging	Het
Cd19	A	G	7: 126,414,823	L5P	unknown	Het
Cd46	A	G	1: 195,042,006	S362P	possibly damaging	Het
Celf5	A	G	10: 81,468,029	S198P	probably damaging	Het
Cep170b	A	G	12: 112,737,925	R706G	possibly damaging	Het
Chd3	G	T	11: 69,369,211	R61S	unknown	Het
Cpsf6	A	C	10: 117,361,822	W253G	unknown	Het
Cyp27a1	G	A	1: 74,737,348	G481D	probably damaging	Het
Ddr1	C	T	17: 35,691,147	D218N	possibly damaging	Het
Dhx34	A	T	7: 16,198,876	V1046D	probably damaging	Het
Dhx9	A	T	1: 153,465,677	D608E	probably benign	Het
Dnajc6	C	A	4: 101,639,372	A912E	probably damaging	Het
Ehmt1	T	C	2: 24,804,782	D1051G	probably damaging	Het
Fam217b	C	A	2: 178,421,203	A320E	probably benign	Het
Farsa	T	A	8: 84,864,060	I169N	probably benign	Het
Fbn2	A	G	18: 58,037,070	C2210R	probably damaging	Het
Fbxo3	T	A	2: 104,050,297	S251T	probably benign	Het
Fer1l6	C	T	15: 58,590,535	T813I	probably benign	Het
Ftl1-ps1	A	T	13: 74,406,995	E131V	probably damaging	Het
Gins3	T	A	8: 95,637,871	I83N	probably damaging	Het
Gja3	T	C	14: 57,035,893	T341A	probably benign	Het
Gja5	A	G	3: 97,050,858	Y77C	probably damaging	Het
Gm14085	C	A	2: 122,522,532	R453S	probably benign	Het
Gm5096	A	G	18: 87,757,466	D371G	possibly damaging	Het
Gm7247	A	G	14: 51,365,351	K48R	probably damaging	Het
Gsx2	C	A	5: 75,075,960	S67*	probably null	Het
H2-Q5	T	A	17: 35,397,113	L217Q		Het
Impg2	T	A	16: 56,267,104	C1095*	probably null	Het
Itga7	G	T	10: 128,940,932	W222L	probably damaging	Het
Kdm2b	T	A	5: 122,921,449	D530V	possibly damaging	Het
Klhdc8a	A	T	1: 132,302,606	D153V	probably damaging	Het
Lin28a	C	T	4: 134,006,308	G143S	probably damaging	Het
Memo1	A	G	17: 74,202,343	L227S	probably damaging	Het
Mettl27	T	A	5: 134,935,803	V138E	probably damaging	Het
Mov10	G	T	3: 104,801,012	L474I	probably damaging	Het
Nat10	T	C	2: 103,726,753	N852S	probably benign	Het
Nfkbie	T	C	17: 45,559,227	V166A	possibly damaging	Het
Nktr	T	C	9: 121,746,533	M369T	probably damaging	Het
Nlrp9a	A	T	7: 26,558,724	N589I	probably benign	Het
Nrn1	G	A	13: 36,730,603	R8C	probably benign	Het
Nrsn1	A	G	13: 25,253,468	I159T	probably damaging	Het
Olfr132	C	T	17: 38,130,433	G253D	probably benign	Het
Olfr389	A	G	11: 73,776,677	S217P	possibly damaging	Het
Olfr485	A	T	7: 108,158,957	D305E	probably benign	Het
Olfr794	G	A	10: 129,570,715	G20D	probably benign	Het
Osbp	T	A	19: 11,978,667	D385E	probably benign	Het
Pan3	T	A	5: 147,526,992	N547K	probably damaging	Het
Pum1	C	A	4: 130,771,981	T1036K	probably damaging	Het
Rad54l2	C	A	9: 106,713,472	R485L	probably damaging	Het
Rps26	A	T	10: 128,625,218	F101I	unknown	Het
Sdsl	T	C	5: 120,460,637	N138S	probably benign	Het
Slc39a6	A	T	18: 24,584,027	H649Q	probably damaging	Het
Snip1	T	A	4: 125,071,480	F226Y	probably benign	Het
Srrd	T	C	5: 112,337,456	T334A	unknown	Het
St14	C	T	9: 31,100,152	D448N	possibly damaging	Het
Tmem270	T	A	5: 134,901,684	Q241L	probably benign	Het
Tmem55a	T	A	4: 14,892,464	D109E	probably damaging	Het
Tubb4b	T	C	2: 25,224,168	D41G	probably benign	Het
Uhrf1bp1l	A	T	10: 89,808,641	Q1181L	probably benign	Het
Usf3	T	C	16: 44,220,005	M1616T	possibly damaging	Het
Vmn2r95	A	T	17: 18,451,983	I733F	possibly damaging	Het
Zfp976	A	T	7: 42,613,260	C385*	probably null	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGGGTGGCCTTAAAATCCAC -3'
(R):5'- CCAAGAGGCCTTTTCCCTTTAAG -3'

Sequencing Primer
(F):5'- GGGAATCTCACTATGTTACCCAGG -3'
(R):5'- AAGATATTTAAGTCAACTGCAGGTAC -3'

Posted On

2019-06-26