Incidental Mutation 'R7226:Mov10'
List |< first << previous [record 45 of 72] next >> last >|
ID562142
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene NameMoloney leukemia virus 10
SynonymsMov-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location104794836-104818563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104801012 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 474 (L474I)
Ref Sequence ENSEMBL: ENSMUSP00000128246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000136148] [ENSMUST00000166979] [ENSMUST00000168015]
Predicted Effect probably damaging
Transcript: ENSMUST00000002297
AA Change: L474I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227
AA Change: L474I

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106775
AA Change: L547I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: L547I

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136148
Predicted Effect possibly damaging
Transcript: ENSMUST00000166979
AA Change: L547I

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: L547I

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168015
AA Change: L474I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227
AA Change: L474I

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104800947 splice site probably benign
IGL01111:Mov10 APN 3 104801405 missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104795945 missense probably damaging 0.98
IGL01463:Mov10 APN 3 104800324 missense probably damaging 1.00
IGL02114:Mov10 APN 3 104795318 unclassified probably benign
IGL02354:Mov10 APN 3 104804121 splice site probably benign
IGL02361:Mov10 APN 3 104804121 splice site probably benign
IGL02692:Mov10 APN 3 104800803 nonsense probably null
IGL03104:Mov10 APN 3 104797307 missense probably damaging 1.00
IGL03121:Mov10 APN 3 104801002 missense probably benign
P0040:Mov10 UTSW 3 104804679 missense probably damaging 1.00
R0025:Mov10 UTSW 3 104804603 missense probably damaging 1.00
R0270:Mov10 UTSW 3 104795405 missense probably benign 0.09
R0747:Mov10 UTSW 3 104802496 missense probably benign 0.41
R1434:Mov10 UTSW 3 104795174 missense probably damaging 1.00
R1482:Mov10 UTSW 3 104804546 missense probably damaging 0.98
R1594:Mov10 UTSW 3 104795411 missense probably damaging 1.00
R1656:Mov10 UTSW 3 104799596 missense probably benign 0.03
R1739:Mov10 UTSW 3 104800282 missense probably damaging 0.98
R1785:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1786:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104801560 splice site probably benign
R1962:Mov10 UTSW 3 104796977 missense probably damaging 1.00
R1993:Mov10 UTSW 3 104799419 missense probably damaging 1.00
R2095:Mov10 UTSW 3 104801531 missense probably damaging 1.00
R2138:Mov10 UTSW 3 104804242 missense probably benign 0.00
R3107:Mov10 UTSW 3 104799724 missense probably damaging 1.00
R4241:Mov10 UTSW 3 104797276 missense probably benign 0.45
R4280:Mov10 UTSW 3 104799779 missense probably damaging 0.98
R4474:Mov10 UTSW 3 104818465 missense probably damaging 1.00
R5227:Mov10 UTSW 3 104802578 missense probably benign
R5391:Mov10 UTSW 3 104802533 missense probably benign 0.12
R5704:Mov10 UTSW 3 104799596 missense probably benign 0.03
R5819:Mov10 UTSW 3 104801512 missense probably damaging 1.00
R5842:Mov10 UTSW 3 104799379 splice site probably benign
R6059:Mov10 UTSW 3 104817950 utr 3 prime probably benign
R6692:Mov10 UTSW 3 104818044 missense probably damaging 0.97
R7633:Mov10 UTSW 3 104797065 missense possibly damaging 0.93
R7637:Mov10 UTSW 3 104795885 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCTCAGGGTTTGACTCCAG -3'
(R):5'- TGGCTTCTTCTCTCGGAGAAC -3'

Sequencing Primer
(F):5'- AGGGTTTGACTCCAGACTCC -3'
(R):5'- CTCTCGGAGAACTTTGTAAGGACC -3'
Posted On2019-06-26