Incidental Mutation 'R7226:Acad8'
ID562163
Institutional Source Beutler Lab
Gene Symbol Acad8
Ensembl Gene ENSMUSG00000031969
Gene Nameacyl-Coenzyme A dehydrogenase family, member 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location26974135-26999566 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 26978430 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 323 (K323*)
Ref Sequence ENSEMBL: ENSMUSP00000054370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060513] [ENSMUST00000120367] [ENSMUST00000128923] [ENSMUST00000132293]
Predicted Effect probably null
Transcript: ENSMUST00000060513
AA Change: K323*
SMART Domains Protein: ENSMUSP00000054370
Gene: ENSMUSG00000031969
AA Change: K323*

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 1e-28 PFAM
Pfam:Acyl-CoA_dh_M 155 207 1.8e-23 PFAM
Pfam:Acyl-CoA_dh_1 261 411 2.9e-47 PFAM
Pfam:Acyl-CoA_dh_2 276 399 1.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120367
AA Change: K323*
SMART Domains Protein: ENSMUSP00000112908
Gene: ENSMUSG00000031969
AA Change: K323*

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 7.8e-29 PFAM
Pfam:Acyl-CoA_dh_M 155 249 3.7e-28 PFAM
Pfam:Acyl-CoA_dh_1 261 411 5.7e-45 PFAM
Pfam:Acyl-CoA_dh_2 276 400 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128923
Predicted Effect probably benign
Transcript: ENSMUST00000132293
Predicted Effect probably benign
Transcript: ENSMUST00000215693
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cold intolerance at young age with a progressive hepatic steatosis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Acad8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Acad8 APN 9 26990594 missense probably damaging 1.00
IGL01721:Acad8 APN 9 26992267 splice site probably benign
R1473:Acad8 UTSW 9 26979041 missense probably benign 0.00
R2102:Acad8 UTSW 9 26985565 nonsense probably null
R3030:Acad8 UTSW 9 26979059 missense probably benign 0.04
R4023:Acad8 UTSW 9 26979185 missense probably benign 0.02
R4276:Acad8 UTSW 9 26978449 missense probably null 0.47
R4667:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4668:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4669:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4898:Acad8 UTSW 9 26978402 missense probably damaging 1.00
R5418:Acad8 UTSW 9 26985557 missense probably damaging 1.00
R5486:Acad8 UTSW 9 26999495 start codon destroyed probably null
R5549:Acad8 UTSW 9 26985551 missense probably damaging 1.00
R5887:Acad8 UTSW 9 26979324 splice site probably null
R5943:Acad8 UTSW 9 26999444 missense probably benign 0.00
R7150:Acad8 UTSW 9 26978454 missense probably damaging 1.00
R7197:Acad8 UTSW 9 26977671 splice site probably null
R7561:Acad8 UTSW 9 26979242 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCCTCCAGATCCTAAGCTAG -3'
(R):5'- TTGCATGTACCTGTGCCACC -3'

Sequencing Primer
(F):5'- GCTAGACAGCTGCTTCCTG -3'
(R):5'- CATGTCACAGTGCCTATGTAGAG -3'
Posted On2019-06-26