Mutagenetix > Incidental Mutation

Incidental Mutation 'R7226:St14'

562164

Institutional Source

Beutler Lab

Gene Symbol

St14

Ensembl Gene

ENSMUSG00000031995

Gene Name

suppression of tumorigenicity 14 (colon carcinoma)

Synonyms

MT-SP1, matriptase, Tmprss14, Prss14, Epithin

MMRRC Submission

045298-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7226 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31089402-31131853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31100152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 448 (D448N)

Ref Sequence

ENSEMBL: ENSMUSP00000034478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034478]

AlphaFold

P56677

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034478
AA Change: D448N

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: D448N

Domain	Start	End	E-Value	Type
transmembrane domain	55	77	N/A	INTRINSIC
Pfam:SEA	88	181	7.9e-17	PFAM
CUB	214	334	4.24e-14	SMART
CUB	340	447	4.37e-25	SMART
LDLa	452	486	2.31e-9	SMART
LDLa	487	523	4.08e-10	SMART
LDLa	524	561	3.98e-13	SMART
LDLa	566	604	1.48e-7	SMART
Tryp_SPc	614	849	1.25e-93	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025B11Rik	C	T	15: 77,558,989	V17I	unknown	Het
Acad8	T	A	9: 26,978,430	K323*	probably null	Het
Adam18	A	T	8: 24,647,808	C339S	probably damaging	Het
Anxa7	A	G	14: 20,460,195	F396L	probably damaging	Het
Ap2m1	T	A	16: 20,539,451	V73D	probably damaging	Het
Asic2	A	T	11: 80,971,514	I270N	probably damaging	Het
Atrn	T	G	2: 130,986,744	C1070G	probably damaging	Het
Bag6	A	G	17: 35,142,945	N517S	unknown	Het
Cavin1	A	C	11: 100,970,458	D3E	probably benign	Het
Cc2d2b	T	C	19: 40,791,307	L571P	unknown	Het
Ccbe1	A	T	18: 66,083,128	C175S	probably damaging	Het
Cd19	A	G	7: 126,414,823	L5P	unknown	Het
Cd46	A	G	1: 195,042,006	S362P	possibly damaging	Het
Celf5	A	G	10: 81,468,029	S198P	probably damaging	Het
Cep170b	A	G	12: 112,737,925	R706G	possibly damaging	Het
Chd3	G	T	11: 69,369,211	R61S	unknown	Het
Cpsf6	A	C	10: 117,361,822	W253G	unknown	Het
Cyp27a1	G	A	1: 74,737,348	G481D	probably damaging	Het
Ddr1	C	T	17: 35,691,147	D218N	possibly damaging	Het
Dhx34	A	T	7: 16,198,876	V1046D	probably damaging	Het
Dhx9	A	T	1: 153,465,677	D608E	probably benign	Het
Dnajc6	C	A	4: 101,639,372	A912E	probably damaging	Het
Ehmt1	T	C	2: 24,804,782	D1051G	probably damaging	Het
Fam217b	C	A	2: 178,421,203	A320E	probably benign	Het
Farsa	T	A	8: 84,864,060	I169N	probably benign	Het
Fbn2	A	G	18: 58,037,070	C2210R	probably damaging	Het
Fbxo3	T	A	2: 104,050,297	S251T	probably benign	Het
Fer1l6	C	T	15: 58,590,535	T813I	probably benign	Het
Ftl1-ps1	A	T	13: 74,406,995	E131V	probably damaging	Het
Gins3	T	A	8: 95,637,871	I83N	probably damaging	Het
Gja3	T	C	14: 57,035,893	T341A	probably benign	Het
Gja5	A	G	3: 97,050,858	Y77C	probably damaging	Het
Gm14085	C	A	2: 122,522,532	R453S	probably benign	Het
Gm5096	A	G	18: 87,757,466	D371G	possibly damaging	Het
Gm7247	A	G	14: 51,365,351	K48R	probably damaging	Het
Gsx2	C	A	5: 75,075,960	S67*	probably null	Het
H2-Q5	T	A	17: 35,397,113	L217Q		Het
Impg2	T	A	16: 56,267,104	C1095*	probably null	Het
Itga7	G	T	10: 128,940,932	W222L	probably damaging	Het
Kdm2b	T	A	5: 122,921,449	D530V	possibly damaging	Het
Klhdc8a	A	T	1: 132,302,606	D153V	probably damaging	Het
Lin28a	C	T	4: 134,006,308	G143S	probably damaging	Het
Memo1	A	G	17: 74,202,343	L227S	probably damaging	Het
Mettl27	T	A	5: 134,935,803	V138E	probably damaging	Het
Mov10	G	T	3: 104,801,012	L474I	probably damaging	Het
Nat10	T	C	2: 103,726,753	N852S	probably benign	Het
Nfkbie	T	C	17: 45,559,227	V166A	possibly damaging	Het
Nktr	T	C	9: 121,746,533	M369T	probably damaging	Het
Nlrp9a	A	T	7: 26,558,724	N589I	probably benign	Het
Nrn1	G	A	13: 36,730,603	R8C	probably benign	Het
Nrsn1	A	G	13: 25,253,468	I159T	probably damaging	Het
Olfr132	C	T	17: 38,130,433	G253D	probably benign	Het
Olfr389	A	G	11: 73,776,677	S217P	possibly damaging	Het
Olfr485	A	T	7: 108,158,957	D305E	probably benign	Het
Olfr794	G	A	10: 129,570,715	G20D	probably benign	Het
Osbp	T	A	19: 11,978,667	D385E	probably benign	Het
Pan3	T	A	5: 147,526,992	N547K	probably damaging	Het
Pum1	C	A	4: 130,771,981	T1036K	probably damaging	Het
Rad54l2	C	A	9: 106,713,472	R485L	probably damaging	Het
Rps26	A	T	10: 128,625,218	F101I	unknown	Het
Sdsl	T	C	5: 120,460,637	N138S	probably benign	Het
Slc39a6	A	T	18: 24,584,027	H649Q	probably damaging	Het
Snip1	T	A	4: 125,071,480	F226Y	probably benign	Het
Srrd	T	C	5: 112,337,456	T334A	unknown	Het
Tmem270	T	A	5: 134,901,684	Q241L	probably benign	Het
Tmem55a	T	A	4: 14,892,464	D109E	probably damaging	Het
Tubb4b	T	C	2: 25,224,168	D41G	probably benign	Het
Uhrf1bp1l	A	T	10: 89,808,641	Q1181L	probably benign	Het
Usf3	T	C	16: 44,220,005	M1616T	possibly damaging	Het
Vmn2r95	A	T	17: 18,451,983	I733F	possibly damaging	Het
Zfp976	A	T	7: 42,613,260	C385*	probably null	Het

Other mutations in St14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:St14	APN	9	31103779	missense	probably damaging	1.00
IGL01443:St14	APN	9	31100193	nonsense	probably null
IGL01816:St14	APN	9	31108267	missense	possibly damaging	0.71
IGL02100:St14	APN	9	31100130	splice site	probably benign
IGL02494:St14	APN	9	31108645	missense	possibly damaging	0.47
IGL02588:St14	APN	9	31090033	splice site	probably benign
IGL02663:St14	APN	9	31100382	splice site	probably null
IGL02711:St14	APN	9	31089900	missense	probably benign	0.05
IGL03130:St14	APN	9	31097071	critical splice donor site	probably null
IGL03296:St14	APN	9	31108712	missense	probably damaging	0.98
IGL03400:St14	APN	9	31096971	splice site	probably benign
R0101:St14	UTSW	9	31097107	missense	probably benign	0.23
R0225:St14	UTSW	9	31108284	critical splice acceptor site	probably null
R0335:St14	UTSW	9	31091324	splice site	probably benign
R0892:St14	UTSW	9	31100428	missense	probably benign	0.38
R1334:St14	UTSW	9	31108210	missense	probably damaging	1.00
R1487:St14	UTSW	9	31097180	missense	probably damaging	1.00
R1521:St14	UTSW	9	31108215	missense	probably benign	0.03
R1782:St14	UTSW	9	31100164	missense	probably damaging	1.00
R1920:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1921:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1922:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1933:St14	UTSW	9	31106212	missense	probably benign	0.00
R2070:St14	UTSW	9	31091373	missense	probably damaging	1.00
R2411:St14	UTSW	9	31108234	missense	probably benign	0.13
R4152:St14	UTSW	9	31090506	missense	probably benign	0.08
R4375:St14	UTSW	9	31090458	missense	probably benign	0.02
R4419:St14	UTSW	9	31096928	missense	probably damaging	1.00
R4747:St14	UTSW	9	31103757	missense	possibly damaging	0.78
R4791:St14	UTSW	9	31095622	missense	probably benign	0.27
R4915:St14	UTSW	9	31108664	nonsense	probably null
R5056:St14	UTSW	9	31097551	splice site	probably null
R5134:St14	UTSW	9	31095583	missense	probably benign	0.00
R5241:St14	UTSW	9	31100418	nonsense	probably null
R5325:St14	UTSW	9	31096978	splice site	probably null
R5644:St14	UTSW	9	31106510	missense	probably benign
R5828:St14	UTSW	9	31091507	missense	probably damaging	1.00
R5922:St14	UTSW	9	31129904	intron	probably benign
R5930:St14	UTSW	9	31103760	missense	probably damaging	1.00
R5963:St14	UTSW	9	31106557	intron	probably benign
R6911:St14	UTSW	9	31106785	missense	probably benign	0.00
R6937:St14	UTSW	9	31129660	splice site	probably null
R6986:St14	UTSW	9	31096549	missense	probably damaging	0.98
R7395:St14	UTSW	9	31096899	missense	probably benign	0.29
R7400:St14	UTSW	9	31108275	missense	probably benign	0.36
R8194:St14	UTSW	9	31131625	start codon destroyed	probably null	0.95
R8886:St14	UTSW	9	31097124	missense	possibly damaging	0.93
R9248:St14	UTSW	9	31091609	missense	probably damaging	1.00
R9440:St14	UTSW	9	31096549	missense	probably damaging	0.98
Z1177:St14	UTSW	9	31090507	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCTCTCTTAACACAGAGTGACACC -3'
(R):5'- AACCACATCCTGGGTATTGGG -3'

Sequencing Primer
(F):5'- CTAGCCAAGCCTTTTTGTGTG -3'
(R):5'- AGGCACCCCCAGTTGTCTG -3'

Posted On

2019-06-26