Mutagenetix > Incidental Mutation

Incidental Mutation 'R7226:Rad54l2'

562165

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7226 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 106713472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 485 (R485L)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046502
AA Change: R485L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: R485L

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025B11Rik	C	T	15: 77,558,989	V17I	unknown	Het
Acad8	T	A	9: 26,978,430	K323*	probably null	Het
Adam18	A	T	8: 24,647,808	C339S	probably damaging	Het
Anxa7	A	G	14: 20,460,195	F396L	probably damaging	Het
Ap2m1	T	A	16: 20,539,451	V73D	probably damaging	Het
Asic2	A	T	11: 80,971,514	I270N	probably damaging	Het
Atrn	T	G	2: 130,986,744	C1070G	probably damaging	Het
Bag6	A	G	17: 35,142,945	N517S	unknown	Het
Cavin1	A	C	11: 100,970,458	D3E	probably benign	Het
Cc2d2b	T	C	19: 40,791,307	L571P	unknown	Het
Ccbe1	A	T	18: 66,083,128	C175S	probably damaging	Het
Cd19	A	G	7: 126,414,823	L5P	unknown	Het
Cd46	A	G	1: 195,042,006	S362P	possibly damaging	Het
Celf5	A	G	10: 81,468,029	S198P	probably damaging	Het
Cep170b	A	G	12: 112,737,925	R706G	possibly damaging	Het
Chd3	G	T	11: 69,369,211	R61S	unknown	Het
Cpsf6	A	C	10: 117,361,822	W253G	unknown	Het
Cyp27a1	G	A	1: 74,737,348	G481D	probably damaging	Het
Ddr1	C	T	17: 35,691,147	D218N	possibly damaging	Het
Dhx34	A	T	7: 16,198,876	V1046D	probably damaging	Het
Dhx9	A	T	1: 153,465,677	D608E	probably benign	Het
Dnajc6	C	A	4: 101,639,372	A912E	probably damaging	Het
Ehmt1	T	C	2: 24,804,782	D1051G	probably damaging	Het
Fam217b	C	A	2: 178,421,203	A320E	probably benign	Het
Farsa	T	A	8: 84,864,060	I169N	probably benign	Het
Fbn2	A	G	18: 58,037,070	C2210R	probably damaging	Het
Fbxo3	T	A	2: 104,050,297	S251T	probably benign	Het
Fer1l6	C	T	15: 58,590,535	T813I	probably benign	Het
Ftl1-ps1	A	T	13: 74,406,995	E131V	probably damaging	Het
Gins3	T	A	8: 95,637,871	I83N	probably damaging	Het
Gja3	T	C	14: 57,035,893	T341A	probably benign	Het
Gja5	A	G	3: 97,050,858	Y77C	probably damaging	Het
Gm14085	C	A	2: 122,522,532	R453S	probably benign	Het
Gm5096	A	G	18: 87,757,466	D371G	possibly damaging	Het
Gm7247	A	G	14: 51,365,351	K48R	probably damaging	Het
Gsx2	C	A	5: 75,075,960	S67*	probably null	Het
H2-Q5	T	A	17: 35,397,113	L217Q		Het
Impg2	T	A	16: 56,267,104	C1095*	probably null	Het
Itga7	G	T	10: 128,940,932	W222L	probably damaging	Het
Kdm2b	T	A	5: 122,921,449	D530V	possibly damaging	Het
Klhdc8a	A	T	1: 132,302,606	D153V	probably damaging	Het
Lin28a	C	T	4: 134,006,308	G143S	probably damaging	Het
Memo1	A	G	17: 74,202,343	L227S	probably damaging	Het
Mettl27	T	A	5: 134,935,803	V138E	probably damaging	Het
Mov10	G	T	3: 104,801,012	L474I	probably damaging	Het
Nat10	T	C	2: 103,726,753	N852S	probably benign	Het
Nfkbie	T	C	17: 45,559,227	V166A	possibly damaging	Het
Nktr	T	C	9: 121,746,533	M369T	probably damaging	Het
Nlrp9a	A	T	7: 26,558,724	N589I	probably benign	Het
Nrn1	G	A	13: 36,730,603	R8C	probably benign	Het
Nrsn1	A	G	13: 25,253,468	I159T	probably damaging	Het
Olfr132	C	T	17: 38,130,433	G253D	probably benign	Het
Olfr389	A	G	11: 73,776,677	S217P	possibly damaging	Het
Olfr485	A	T	7: 108,158,957	D305E	probably benign	Het
Olfr794	G	A	10: 129,570,715	G20D	probably benign	Het
Osbp	T	A	19: 11,978,667	D385E	probably benign	Het
Pan3	T	A	5: 147,526,992	N547K	probably damaging	Het
Pum1	C	A	4: 130,771,981	T1036K	probably damaging	Het
Rps26	A	T	10: 128,625,218	F101I	unknown	Het
Sdsl	T	C	5: 120,460,637	N138S	probably benign	Het
Slc39a6	A	T	18: 24,584,027	H649Q	probably damaging	Het
Snip1	T	A	4: 125,071,480	F226Y	probably benign	Het
Srrd	T	C	5: 112,337,456	T334A	unknown	Het
St14	C	T	9: 31,100,152	D448N	possibly damaging	Het
Tmem270	T	A	5: 134,901,684	Q241L	probably benign	Het
Tmem55a	T	A	4: 14,892,464	D109E	probably damaging	Het
Tubb4b	T	C	2: 25,224,168	D41G	probably benign	Het
Uhrf1bp1l	A	T	10: 89,808,641	Q1181L	probably benign	Het
Usf3	T	C	16: 44,220,005	M1616T	possibly damaging	Het
Vmn2r95	A	T	17: 18,451,983	I733F	possibly damaging	Het
Zfp976	A	T	7: 42,613,260	C385*	probably null	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCCACTACCCATAGAAGG -3'
(R):5'- ATTGACTAAGAGCAGGCCCTC -3'

Sequencing Primer
(F):5'- TGTGCAAAACATGGCTCCG -3'
(R):5'- TAAGAGCAGGCCCTCTCACC -3'

Posted On

2019-06-26