Incidental Mutation 'R7226:Nktr'
ID562166
Institutional Source Beutler Lab
Gene Symbol Nktr
Ensembl Gene ENSMUSG00000032525
Gene Namenatural killer tumor recognition sequence
Synonyms5330401F18Rik, D9Wsu172e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location121719169-121756843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121746533 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 369 (M369T)
Ref Sequence ENSEMBL: ENSMUSP00000035112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035112] [ENSMUST00000182179] [ENSMUST00000182225] [ENSMUST00000182503] [ENSMUST00000182763] [ENSMUST00000183070]
Predicted Effect probably damaging
Transcript: ENSMUST00000035112
AA Change: M369T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035112
Gene: ENSMUSG00000032525
AA Change: M369T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 1.7e-48 PFAM
low complexity region 195 229 N/A INTRINSIC
low complexity region 277 294 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
low complexity region 427 459 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
low complexity region 509 565 N/A INTRINSIC
low complexity region 677 726 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 921 929 N/A INTRINSIC
low complexity region 948 958 N/A INTRINSIC
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1189 1200 N/A INTRINSIC
low complexity region 1229 1236 N/A INTRINSIC
low complexity region 1316 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182179
SMART Domains Protein: ENSMUSP00000138437
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182225
AA Change: M344T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138168
Gene: ENSMUSG00000032525
AA Change: M344T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 2.1e-47 PFAM
low complexity region 184 215 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
low complexity region 402 434 N/A INTRINSIC
low complexity region 452 478 N/A INTRINSIC
low complexity region 484 540 N/A INTRINSIC
low complexity region 652 701 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
low complexity region 875 889 N/A INTRINSIC
low complexity region 896 904 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182503
SMART Domains Protein: ENSMUSP00000138463
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
low complexity region 10 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182763
SMART Domains Protein: ENSMUSP00000138272
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 68 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183070
SMART Domains Protein: ENSMUSP00000138611
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Nktr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Nktr APN 9 121731564 missense possibly damaging 0.94
IGL01402:Nktr APN 9 121741152 splice site probably null
IGL01404:Nktr APN 9 121741152 splice site probably null
IGL02945:Nktr APN 9 121728631 missense probably damaging 1.00
IGL03334:Nktr APN 9 121748176 missense probably benign 0.18
IGL03134:Nktr UTSW 9 121746466 missense probably damaging 1.00
PIT4131001:Nktr UTSW 9 121741621 missense probably damaging 1.00
R0010:Nktr UTSW 9 121741166 splice site probably benign
R0158:Nktr UTSW 9 121750691 unclassified probably benign
R0399:Nktr UTSW 9 121731484 missense probably damaging 0.98
R0503:Nktr UTSW 9 121750740 unclassified probably benign
R0585:Nktr UTSW 9 121754280 utr 3 prime probably benign
R0606:Nktr UTSW 9 121749290 unclassified probably benign
R1248:Nktr UTSW 9 121727370 missense probably damaging 1.00
R1899:Nktr UTSW 9 121748866 unclassified probably benign
R1912:Nktr UTSW 9 121750240 unclassified probably benign
R2049:Nktr UTSW 9 121741694 missense probably damaging 1.00
R2279:Nktr UTSW 9 121731537 missense possibly damaging 0.93
R2912:Nktr UTSW 9 121749604 unclassified probably benign
R2913:Nktr UTSW 9 121749604 unclassified probably benign
R2914:Nktr UTSW 9 121749604 unclassified probably benign
R3939:Nktr UTSW 9 121749069 unclassified probably benign
R4080:Nktr UTSW 9 121741126 missense probably damaging 1.00
R4471:Nktr UTSW 9 121748896 unclassified probably benign
R4472:Nktr UTSW 9 121748896 unclassified probably benign
R4506:Nktr UTSW 9 121748883 unclassified probably benign
R4556:Nktr UTSW 9 121741123 missense probably damaging 0.98
R4736:Nktr UTSW 9 121749739 unclassified probably benign
R4749:Nktr UTSW 9 121741693 missense probably damaging 1.00
R4943:Nktr UTSW 9 121719954 intron probably benign
R5084:Nktr UTSW 9 121748110 missense possibly damaging 0.86
R5250:Nktr UTSW 9 121749792 unclassified probably benign
R5288:Nktr UTSW 9 121748593 missense probably benign 0.23
R5324:Nktr UTSW 9 121727346 missense probably damaging 1.00
R5330:Nktr UTSW 9 121752768 intron probably benign
R5331:Nktr UTSW 9 121752768 intron probably benign
R5502:Nktr UTSW 9 121748606 unclassified probably benign
R5587:Nktr UTSW 9 121748489 unclassified probably benign
R5664:Nktr UTSW 9 121749417 nonsense probably null
R6005:Nktr UTSW 9 121748394 unclassified probably benign
R6057:Nktr UTSW 9 121748389 unclassified probably benign
R6083:Nktr UTSW 9 121750136 unclassified probably benign
R6274:Nktr UTSW 9 121731565 missense probably damaging 1.00
R6445:Nktr UTSW 9 121748414 unclassified probably benign
R6467:Nktr UTSW 9 121731519 missense probably damaging 1.00
R6911:Nktr UTSW 9 121754326 nonsense probably null
R6960:Nktr UTSW 9 121742692 missense probably damaging 0.99
R7324:Nktr UTSW 9 121727361 missense probably damaging 1.00
R7324:Nktr UTSW 9 121748291 missense possibly damaging 0.66
R7451:Nktr UTSW 9 121729656 missense probably damaging 0.99
R7464:Nktr UTSW 9 121750327 missense unknown
R7537:Nktr UTSW 9 121749279 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGCCTGCATTAGATCTTTTGC -3'
(R):5'- GCCTGAGGCCTTATCACTTC -3'

Sequencing Primer
(F):5'- GCCTGACTCTGTCCTACAAGAG -3'
(R):5'- TGACTGAAGAGCCTTCGTCTCAG -3'
Posted On2019-06-26