Incidental Mutation 'R7226:Itga7'
ID562171
Institutional Source Beutler Lab
Gene Symbol Itga7
Ensembl Gene ENSMUSG00000025348
Gene Nameintegrin alpha 7
Synonyms[a]7, alpha7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128933818-128958282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128940932 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 222 (W222L)
Ref Sequence ENSEMBL: ENSMUSP00000151960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099112] [ENSMUST00000218290]
Predicted Effect probably damaging
Transcript: ENSMUST00000099112
AA Change: W222L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: W222L

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218290
AA Change: W222L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Itga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Itga7 APN 10 128941854 missense possibly damaging 0.67
IGL00809:Itga7 APN 10 128939169 critical splice donor site probably null
IGL01448:Itga7 APN 10 128949468 nonsense probably null
IGL01675:Itga7 APN 10 128946855 missense probably damaging 1.00
IGL02158:Itga7 APN 10 128953782 missense possibly damaging 0.95
IGL02475:Itga7 APN 10 128934089 missense probably damaging 1.00
IGL02689:Itga7 APN 10 128946818 missense possibly damaging 0.83
IGL02946:Itga7 APN 10 128934083 missense probably benign
IGL03223:Itga7 APN 10 128948811 unclassified probably benign
R0662:Itga7 UTSW 10 128953531 missense probably damaging 1.00
R0972:Itga7 UTSW 10 128942877 missense probably damaging 0.98
R1449:Itga7 UTSW 10 128953501 missense probably benign 0.13
R1521:Itga7 UTSW 10 128957811 missense possibly damaging 0.63
R1597:Itga7 UTSW 10 128946863 missense probably benign 0.17
R1651:Itga7 UTSW 10 128948824 missense probably benign 0.01
R4718:Itga7 UTSW 10 128940734 frame shift probably null
R5011:Itga7 UTSW 10 128949447 missense possibly damaging 0.51
R5151:Itga7 UTSW 10 128944511 missense possibly damaging 0.91
R5287:Itga7 UTSW 10 128943158 missense probably benign 0.38
R5419:Itga7 UTSW 10 128944033 missense probably null 0.06
R5907:Itga7 UTSW 10 128942981 missense probably damaging 1.00
R6165:Itga7 UTSW 10 128942935 missense probably benign 0.16
R6189:Itga7 UTSW 10 128950403 missense possibly damaging 0.76
R6263:Itga7 UTSW 10 128944086 missense probably benign
R6612:Itga7 UTSW 10 128948993 missense possibly damaging 0.65
R6746:Itga7 UTSW 10 128949472 missense probably benign 0.13
R6850:Itga7 UTSW 10 128945516 missense probably damaging 1.00
R7257:Itga7 UTSW 10 128944413 missense possibly damaging 0.55
R7344:Itga7 UTSW 10 128940929 missense possibly damaging 0.63
R7456:Itga7 UTSW 10 128941936 missense probably damaging 1.00
R7545:Itga7 UTSW 10 128933906 start gained probably benign
R7643:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7644:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7822:Itga7 UTSW 10 128942966 missense probably benign 0.00
X0020:Itga7 UTSW 10 128942877 missense probably damaging 0.98
Z1088:Itga7 UTSW 10 128949163 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCTTTGTGCTAAGCCAGGAC -3'
(R):5'- TGTAGATAAACACATAGCCATGCG -3'

Sequencing Primer
(F):5'- ACCTGGCCATCCGTGATGAG -3'
(R):5'- GATGGAGAATAGGTACCCCCATTC -3'
Posted On2019-06-26