Incidental Mutation 'R0576:Mynn'
ID56218
Institutional Source Beutler Lab
Gene Symbol Mynn
Ensembl Gene ENSMUSG00000037730
Gene Namemyoneurin
SynonymsSBBIZ1, 2810011C24Rik
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R0576 (G1)
Quality Score154
Status Validated
Chromosome3
Chromosomal Location30602065-30619873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30607068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 100 (D100Y)
Ref Sequence ENSEMBL: ENSMUSP00000141951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably damaging
Transcript: ENSMUST00000047502
AA Change: D100Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730
AA Change: D100Y

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192715
AA Change: D100Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730
AA Change: D100Y

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194587
Predicted Effect silent
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect silent
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.3490 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ and zinc finger domain-containing protein family that are involved in the control of gene expression. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 14. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Mynn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Mynn APN 3 30613606 missense probably damaging 0.99
IGL01544:Mynn APN 3 30607705 nonsense probably null
IGL02084:Mynn APN 3 30611615 missense probably damaging 1.00
IGL02189:Mynn APN 3 30613544 splice site probably benign
IGL02261:Mynn APN 3 30607131 missense possibly damaging 0.67
IGL02541:Mynn APN 3 30611603 missense probably damaging 0.98
IGL02681:Mynn APN 3 30616642 missense probably benign 0.36
IGL03167:Mynn APN 3 30609042 missense probably damaging 1.00
PIT4494001:Mynn UTSW 3 30607722 nonsense probably null
R0049:Mynn UTSW 3 30607081 makesense probably null
R0321:Mynn UTSW 3 30607557 missense probably benign 0.01
R0420:Mynn UTSW 3 30607459 missense probably benign 0.42
R0574:Mynn UTSW 3 30616739 missense probably benign 0.01
R1460:Mynn UTSW 3 30603704 missense probably damaging 0.99
R1882:Mynn UTSW 3 30616813 makesense probably null
R3115:Mynn UTSW 3 30607810 missense probably damaging 1.00
R3442:Mynn UTSW 3 30613563 missense probably damaging 0.99
R4930:Mynn UTSW 3 30607042 missense probably damaging 1.00
R5153:Mynn UTSW 3 30611589 missense probably benign 0.00
R5351:Mynn UTSW 3 30607542 missense probably benign 0.01
R7446:Mynn UTSW 3 30607052 missense probably benign 0.01
R7468:Mynn UTSW 3 30603676 missense probably damaging 1.00
R7543:Mynn UTSW 3 30607039 nonsense probably null
R8105:Mynn UTSW 3 30611479 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCTGCCATCTTCAGGAGAGTG -3'
(R):5'- GAGACGATTTCTTTGTCAATGCCCG -3'

Sequencing Primer
(F):5'- GGTCACAGTGCCTTCTCAG -3'
(R):5'- TTGCCTGAACTGAGTCCG -3'
Posted On2013-07-11