Incidental Mutation 'R7226:Ddr1'
ID562192
Institutional Source Beutler Lab
Gene Symbol Ddr1
Ensembl Gene ENSMUSG00000003534
Gene Namediscoidin domain receptor family, member 1
SynonymsCak, CD167a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35681567-35704621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35691147 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 218 (D218N)
Ref Sequence ENSEMBL: ENSMUSP00000003628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003628] [ENSMUST00000097333] [ENSMUST00000117301] [ENSMUST00000119825] [ENSMUST00000134995] [ENSMUST00000135078] [ENSMUST00000145900] [ENSMUST00000146472] [ENSMUST00000148065] [ENSMUST00000155628] [ENSMUST00000155957] [ENSMUST00000166980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003628
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003628
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097333
AA Change: D218N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094945
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
TyrKc 571 866 8.14e-129 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117301
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112570
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 4e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119825
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113062
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134995
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117301
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 264 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135078
SMART Domains Protein: ENSMUSP00000122191
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4AG4|A 30 89 5e-22 PDB
Blast:FA58C 31 89 6e-25 BLAST
SCOP:d1d7pm_ 32 78 5e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145900
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122361
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146472
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119397
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148065
AA Change: D88N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120635
Gene: ENSMUSG00000003534
AA Change: D88N

DomainStartEndE-ValueType
Blast:FA58C 1 56 2e-33 BLAST
SCOP:d1d7pm_ 1 58 2e-11 SMART
PDB:4AG4|A 1 143 3e-73 PDB
Blast:FA58C 109 143 1e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000155628
AA Change: D218N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133659
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 319 1e-45 BLAST
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
PDB:4CKR|A 562 584 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155957
SMART Domains Protein: ENSMUSP00000117427
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 192 209 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166980
AA Change: D218N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133047
Gene: ENSMUSG00000003534
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutant mice are viable but smaller than control mice. Most mutant females are not able to give birth because developing blastocysts fail to implant. Successfully reproducing females show a lactation defect which is attributed to hyperproliferation and aberrant branching of mammary ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Ddr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02126:Ddr1 APN 17 35688589 missense probably damaging 0.99
IGL02167:Ddr1 APN 17 35690071 missense possibly damaging 0.55
IGL02250:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02251:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02367:Ddr1 APN 17 35683480 missense probably damaging 1.00
PIT4449001:Ddr1 UTSW 17 35687249 missense possibly damaging 0.54
R0538:Ddr1 UTSW 17 35685007 missense probably damaging 1.00
R0674:Ddr1 UTSW 17 35689669 nonsense probably null
R4829:Ddr1 UTSW 17 35685113 missense probably damaging 1.00
R4940:Ddr1 UTSW 17 35690130 missense probably damaging 1.00
R5085:Ddr1 UTSW 17 35682775 critical splice acceptor site probably null
R5112:Ddr1 UTSW 17 35682485 missense probably benign
R5124:Ddr1 UTSW 17 35683597 missense probably damaging 1.00
R5652:Ddr1 UTSW 17 35686508 missense probably benign
R5653:Ddr1 UTSW 17 35686508 missense probably benign
R5654:Ddr1 UTSW 17 35686508 missense probably benign
R6427:Ddr1 UTSW 17 35687222 missense probably benign
R7405:Ddr1 UTSW 17 35690100 missense probably damaging 1.00
R7534:Ddr1 UTSW 17 35682622 critical splice donor site probably null
R7568:Ddr1 UTSW 17 35684282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTACCCATTGCTCTAC -3'
(R):5'- GGCACTAAACTGCATAGCCTTC -3'

Sequencing Primer
(F):5'- GTGCACATACACGTGTAGACATGTAC -3'
(R):5'- GCATAGCCTTCTCCACACTAGTG -3'
Posted On2019-06-26