Incidental Mutation 'R0576:Usp33'
ID56220
Institutional Source Beutler Lab
Gene Symbol Usp33
Ensembl Gene ENSMUSG00000025437
Gene Nameubiquitin specific peptidase 33
SynonymsVdu1, 9830169D19Rik
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R0576 (G1)
Quality Score134
Status Validated
Chromosome3
Chromosomal Location152346478-152393617 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 152384119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 765 (Y765*)
Ref Sequence ENSEMBL: ENSMUSP00000142708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026507] [ENSMUST00000117492] [ENSMUST00000197748]
Predicted Effect probably null
Transcript: ENSMUST00000026507
AA Change: Y757*
SMART Domains Protein: ENSMUSP00000026507
Gene: ENSMUSG00000025437
AA Change: Y757*

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 671 2.2e-71 PFAM
Pfam:UCH_1 154 387 1.4e-9 PFAM
Pfam:UCH_1 371 653 6.8e-25 PFAM
DUSP 691 774 4.4e-17 SMART
DUSP 799 883 2.44e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117492
AA Change: Y757*
SMART Domains Protein: ENSMUSP00000113265
Gene: ENSMUSG00000025437
AA Change: Y757*

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 1.6e-64 PFAM
Pfam:UCH_1 154 387 1.2e-8 PFAM
Pfam:UCH_1 366 661 1.3e-23 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197325
Predicted Effect probably null
Transcript: ENSMUST00000197748
AA Change: Y765*
SMART Domains Protein: ENSMUSP00000142708
Gene: ENSMUSG00000025437
AA Change: Y765*

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 2.3e-71 PFAM
Pfam:UCH_1 154 383 1.2e-9 PFAM
Pfam:UCH_1 368 661 1e-24 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200075
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Usp33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Usp33 APN 3 152373409 missense probably benign 0.00
IGL01085:Usp33 APN 3 152368569 missense possibly damaging 0.89
IGL01335:Usp33 APN 3 152392217 missense probably damaging 0.99
IGL02095:Usp33 APN 3 152381794 missense possibly damaging 0.94
IGL02323:Usp33 APN 3 152370387 missense probably benign
IGL03010:Usp33 APN 3 152368596 missense probably benign 0.04
R0464:Usp33 UTSW 3 152376235 splice site probably benign
R0583:Usp33 UTSW 3 152368254 missense probably damaging 1.00
R0715:Usp33 UTSW 3 152380574 missense probably damaging 1.00
R1445:Usp33 UTSW 3 152368634 missense probably damaging 0.99
R1507:Usp33 UTSW 3 152374763 missense possibly damaging 0.84
R1600:Usp33 UTSW 3 152379610 missense probably damaging 0.98
R1673:Usp33 UTSW 3 152368282 missense probably damaging 1.00
R1945:Usp33 UTSW 3 152379586 missense probably benign 0.07
R1961:Usp33 UTSW 3 152380628 missense probably damaging 1.00
R1973:Usp33 UTSW 3 152360286 missense possibly damaging 0.64
R2231:Usp33 UTSW 3 152373386 missense probably benign 0.00
R2299:Usp33 UTSW 3 152374621 missense probably damaging 0.99
R3001:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3002:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3923:Usp33 UTSW 3 152374791 critical splice donor site probably null
R4366:Usp33 UTSW 3 152368512 missense probably benign 0.44
R4821:Usp33 UTSW 3 152358673 missense probably benign 0.00
R5256:Usp33 UTSW 3 152391696 nonsense probably null
R5396:Usp33 UTSW 3 152384187 missense possibly damaging 0.77
R5445:Usp33 UTSW 3 152374623 missense probably damaging 1.00
R5877:Usp33 UTSW 3 152379476 missense possibly damaging 0.91
R5877:Usp33 UTSW 3 152379596 missense probably damaging 1.00
R5884:Usp33 UTSW 3 152368330 missense probably benign
R5913:Usp33 UTSW 3 152380592 missense probably damaging 1.00
R5920:Usp33 UTSW 3 152374683 missense probably damaging 1.00
R6331:Usp33 UTSW 3 152376250 missense probably damaging 1.00
R6516:Usp33 UTSW 3 152373416 missense probably benign 0.01
R6624:Usp33 UTSW 3 152381798 missense probably damaging 1.00
R6679:Usp33 UTSW 3 152368487 missense possibly damaging 0.46
R7196:Usp33 UTSW 3 152384191 missense possibly damaging 0.87
R7250:Usp33 UTSW 3 152392362 nonsense probably null
R7310:Usp33 UTSW 3 152360389 nonsense probably null
R7569:Usp33 UTSW 3 152391665 missense probably damaging 1.00
R7644:Usp33 UTSW 3 152357952 missense possibly damaging 0.47
R8118:Usp33 UTSW 3 152360359 missense probably damaging 1.00
R8229:Usp33 UTSW 3 152370292 missense probably benign
R8333:Usp33 UTSW 3 152374660 missense probably damaging 1.00
X0025:Usp33 UTSW 3 152366758 missense probably damaging 1.00
X0058:Usp33 UTSW 3 152360346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTAGGGACTTGGTGACGAAAC -3'
(R):5'- CTTCTTGCCACGGCAAATGCATAG -3'

Sequencing Primer
(F):5'- ggcacttggaggacagc -3'
(R):5'- TGGCTATGCAGGCAGGC -3'
Posted On2013-07-11