Incidental Mutation 'R7227:2310007B03Rik'
ID562202
Institutional Source Beutler Lab
Gene Symbol 2310007B03Rik
Ensembl Gene ENSMUSG00000034159
Gene NameRIKEN cDNA 2310007B03 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7227 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93151349-93160948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93152014 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 451 (N451K)
Ref Sequence ENSEMBL: ENSMUSP00000035332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043718] [ENSMUST00000143419]
Predicted Effect probably benign
Transcript: ENSMUST00000043718
AA Change: N451K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035332
Gene: ENSMUSG00000034159
AA Change: N451K

DomainStartEndE-ValueType
Mab-21 71 372 2.18e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143419
AA Change: N451K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115971
Gene: ENSMUSG00000034159
AA Change: N451K

DomainStartEndE-ValueType
Mab-21 71 372 2.18e-52 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,350,720 L344H probably damaging Het
Abcb1b T A 5: 8,825,593 S589T probably damaging Het
Acsm2 A C 7: 119,591,333 I520L probably benign Het
Ap2a2 T C 7: 141,620,871 Y544H probably damaging Het
Ascc1 T A 10: 60,007,738 Y41N probably benign Het
Bend3 T A 10: 43,511,405 L598Q probably damaging Het
Cfap74 T G 4: 155,460,948 Y1108* probably null Het
Cxcl17 C A 7: 25,402,894 R41S probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Dnah2 A G 11: 69,421,396 Y4370H probably damaging Het
Dzip3 T A 16: 48,951,569 Q579L probably damaging Het
Enpp3 C T 10: 24,817,844 M195I unknown Het
Esyt2 A G 12: 116,342,125 D325G probably damaging Het
Fat1 T G 8: 45,010,609 I1396S probably benign Het
Gigyf1 T A 5: 137,523,823 I661K unknown Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Hivep1 T C 13: 42,156,911 S876P probably benign Het
Hk3 C T 13: 55,012,240 R362H probably benign Het
Ier3ip1 T A 18: 76,939,634 M53K probably benign Het
Klhl5 T C 5: 65,141,288 S137P probably benign Het
Kremen2 G T 17: 23,744,599 Y70* probably null Het
Lag3 C T 6: 124,908,494 G308S possibly damaging Het
Map4k2 T A 19: 6,346,594 L542Q probably damaging Het
Mef2d G A 3: 88,158,207 probably null Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mpp3 T A 11: 102,005,078 Y457F possibly damaging Het
Mrpl12 T A 11: 120,488,352 I175N probably damaging Het
Mybbp1a G T 11: 72,447,759 K728N possibly damaging Het
Nfkb1 C T 3: 135,626,659 V112M probably damaging Het
Nucb2 A T 7: 116,526,076 D123V probably damaging Het
Olfr527 A G 7: 140,335,621 probably benign Het
Orc3 T C 4: 34,572,542 T629A probably benign Het
Pdk1 T A 2: 71,883,901 N218K possibly damaging Het
Plce1 A G 19: 38,726,902 T1298A probably benign Het
Ppan T A 9: 20,888,200 probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Scn2a A C 2: 65,752,023 I1572L probably damaging Het
Sec16a A T 2: 26,438,923 Y1027N probably benign Het
Serpinb3a T A 1: 107,051,629 T48S probably damaging Het
Slc30a8 A G 15: 52,331,636 M264V probably benign Het
Slc44a3 A T 3: 121,510,230 C286S possibly damaging Het
Slc8a2 T C 7: 16,144,981 I464T possibly damaging Het
Smco1 T C 16: 32,274,015 M168T possibly damaging Het
Spns2 A T 11: 72,458,687 Y246* probably null Het
Ssbp2 T C 13: 91,675,125 M213T probably benign Het
Stk40 G T 4: 126,123,766 A29S probably benign Het
Thrap3 A T 4: 126,173,503 F683I probably damaging Het
Tmc5 A G 7: 118,670,666 T880A possibly damaging Het
Trim38 T A 13: 23,785,963 N168K possibly damaging Het
Ube2d1 T A 10: 71,255,872 Y134F possibly damaging Het
Vmn1r67 T A 7: 10,447,548 Y246* probably null Het
Vmn2r18 T C 5: 151,572,799 T485A probably damaging Het
Wrn T A 8: 33,248,946 I1285F probably damaging Het
Xrcc1 C A 7: 24,547,332 H8Q probably damaging Het
Zkscan4 T C 13: 21,484,243 V317A probably benign Het
Other mutations in 2310007B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:2310007B03Rik APN 1 93152072 missense probably damaging 0.98
R0018:2310007B03Rik UTSW 1 93154605 missense probably benign 0.00
R0115:2310007B03Rik UTSW 1 93159725 missense possibly damaging 0.70
R0467:2310007B03Rik UTSW 1 93153044 missense probably damaging 1.00
R1452:2310007B03Rik UTSW 1 93152939 missense probably damaging 1.00
R1938:2310007B03Rik UTSW 1 93152008 makesense probably null
R3156:2310007B03Rik UTSW 1 93160042 missense possibly damaging 0.95
R4740:2310007B03Rik UTSW 1 93156168 missense probably benign 0.01
R5260:2310007B03Rik UTSW 1 93159978 missense probably damaging 0.99
R5283:2310007B03Rik UTSW 1 93159853 missense probably benign 0.02
R5645:2310007B03Rik UTSW 1 93152946 missense probably damaging 1.00
R6380:2310007B03Rik UTSW 1 93160891 splice site probably null
R6738:2310007B03Rik UTSW 1 93159985 missense probably benign 0.30
R7184:2310007B03Rik UTSW 1 93154515 missense probably benign 0.00
R7562:2310007B03Rik UTSW 1 93159967 missense probably damaging 1.00
R8001:2310007B03Rik UTSW 1 93154599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACTCAGACTGGAACATGG -3'
(R):5'- TGGAGTGGTCCACCTTCATG -3'

Sequencing Primer
(F):5'- ACTGGAACATGGCAGCTGC -3'
(R):5'- CATGGATACTGGCCCTGTGGTAC -3'
Posted On2019-06-26