Incidental Mutation 'R7227:Serpinb3a'
ID562203
Institutional Source Beutler Lab
Gene Symbol Serpinb3a
Ensembl Gene ENSMUSG00000044594
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
SynonymsSqn5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7227 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107045587-107052303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107051629 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 48 (T48S)
Ref Sequence ENSEMBL: ENSMUSP00000027567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]
Predicted Effect probably damaging
Transcript: ENSMUST00000027567
AA Change: T48S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594
AA Change: T48S

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112717
AA Change: T48S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594
AA Change: T48S

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G T 1: 93,152,014 N451K probably benign Het
2310057M21Rik A T 7: 131,350,720 L344H probably damaging Het
Abcb1b T A 5: 8,825,593 S589T probably damaging Het
Acsm2 A C 7: 119,591,333 I520L probably benign Het
Ap2a2 T C 7: 141,620,871 Y544H probably damaging Het
Ascc1 T A 10: 60,007,738 Y41N probably benign Het
Bend3 T A 10: 43,511,405 L598Q probably damaging Het
Cfap74 T G 4: 155,460,948 Y1108* probably null Het
Cxcl17 C A 7: 25,402,894 R41S probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Dnah2 A G 11: 69,421,396 Y4370H probably damaging Het
Dzip3 T A 16: 48,951,569 Q579L probably damaging Het
Enpp3 C T 10: 24,817,844 M195I unknown Het
Esyt2 A G 12: 116,342,125 D325G probably damaging Het
Fat1 T G 8: 45,010,609 I1396S probably benign Het
Gigyf1 T A 5: 137,523,823 I661K unknown Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Hivep1 T C 13: 42,156,911 S876P probably benign Het
Hk3 C T 13: 55,012,240 R362H probably benign Het
Ier3ip1 T A 18: 76,939,634 M53K probably benign Het
Klhl5 T C 5: 65,141,288 S137P probably benign Het
Kremen2 G T 17: 23,744,599 Y70* probably null Het
Lag3 C T 6: 124,908,494 G308S possibly damaging Het
Map4k2 T A 19: 6,346,594 L542Q probably damaging Het
Mef2d G A 3: 88,158,207 probably null Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mpp3 T A 11: 102,005,078 Y457F possibly damaging Het
Mrpl12 T A 11: 120,488,352 I175N probably damaging Het
Mybbp1a G T 11: 72,447,759 K728N possibly damaging Het
Nfkb1 C T 3: 135,626,659 V112M probably damaging Het
Nucb2 A T 7: 116,526,076 D123V probably damaging Het
Olfr527 A G 7: 140,335,621 probably benign Het
Orc3 T C 4: 34,572,542 T629A probably benign Het
Pdk1 T A 2: 71,883,901 N218K possibly damaging Het
Plce1 A G 19: 38,726,902 T1298A probably benign Het
Ppan T A 9: 20,888,200 probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Scn2a A C 2: 65,752,023 I1572L probably damaging Het
Sec16a A T 2: 26,438,923 Y1027N probably benign Het
Slc30a8 A G 15: 52,331,636 M264V probably benign Het
Slc44a3 A T 3: 121,510,230 C286S possibly damaging Het
Slc8a2 T C 7: 16,144,981 I464T possibly damaging Het
Smco1 T C 16: 32,274,015 M168T possibly damaging Het
Spns2 A T 11: 72,458,687 Y246* probably null Het
Ssbp2 T C 13: 91,675,125 M213T probably benign Het
Stk40 G T 4: 126,123,766 A29S probably benign Het
Thrap3 A T 4: 126,173,503 F683I probably damaging Het
Tmc5 A G 7: 118,670,666 T880A possibly damaging Het
Trim38 T A 13: 23,785,963 N168K possibly damaging Het
Ube2d1 T A 10: 71,255,872 Y134F possibly damaging Het
Vmn1r67 T A 7: 10,447,548 Y246* probably null Het
Vmn2r18 T C 5: 151,572,799 T485A probably damaging Het
Wrn T A 8: 33,248,946 I1285F probably damaging Het
Xrcc1 C A 7: 24,547,332 H8Q probably damaging Het
Zkscan4 T C 13: 21,484,243 V317A probably benign Het
Other mutations in Serpinb3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Serpinb3a APN 1 107051059 nonsense probably null
IGL01940:Serpinb3a APN 1 107046185 missense probably damaging 1.00
IGL02077:Serpinb3a APN 1 107046381 missense probably damaging 0.99
IGL02136:Serpinb3a APN 1 107046285 missense probably benign 0.15
IGL02214:Serpinb3a APN 1 107048488 critical splice donor site probably null
IGL02239:Serpinb3a APN 1 107051688 missense probably benign 0.05
IGL02508:Serpinb3a APN 1 107046072 missense probably damaging 1.00
IGL02533:Serpinb3a APN 1 107047162 missense probably benign 0.00
IGL02860:Serpinb3a APN 1 107049453 splice site probably benign
IGL03013:Serpinb3a APN 1 107046083 missense probably damaging 1.00
IGL03391:Serpinb3a APN 1 107046342 missense possibly damaging 0.81
R0321:Serpinb3a UTSW 1 107047482 nonsense probably null
R0416:Serpinb3a UTSW 1 107049386 missense probably benign 0.29
R0494:Serpinb3a UTSW 1 107047482 nonsense probably null
R0498:Serpinb3a UTSW 1 107047150 missense probably damaging 1.00
R1223:Serpinb3a UTSW 1 107047552 missense probably damaging 1.00
R1596:Serpinb3a UTSW 1 107047174 missense probably benign 0.12
R1655:Serpinb3a UTSW 1 107046212 missense probably damaging 1.00
R2156:Serpinb3a UTSW 1 107047472 critical splice donor site probably null
R2296:Serpinb3a UTSW 1 107047561 missense probably damaging 1.00
R4327:Serpinb3a UTSW 1 107051770 start codon destroyed probably damaging 1.00
R4612:Serpinb3a UTSW 1 107047607 missense probably damaging 0.99
R4830:Serpinb3a UTSW 1 107048586 missense probably benign 0.00
R5016:Serpinb3a UTSW 1 107046330 missense probably damaging 1.00
R5483:Serpinb3a UTSW 1 107047169 missense probably benign 0.16
R5619:Serpinb3a UTSW 1 107047108 missense probably damaging 1.00
Z1177:Serpinb3a UTSW 1 107051008 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACCCAAGGGATATCAGGAATC -3'
(R):5'- TGTCCTAGGACTTCAAGTTCCC -3'

Sequencing Primer
(F):5'- TATCAGGAATCAACTGGACTGTG -3'
(R):5'- TAGGACTTCAAGTTCCCACTAAG -3'
Posted On2019-06-26